EMAIL THIS PAGE TO A FRIEND

RGSL1

regulator of G-protein signaling like 1

93 Gene Product Result for
Synonyms: RGSL RGSL2
Gene ID:
Mouse(240816) regulator of G-protein signaling like 1
Rat(690116) regulator of G-protein signaling like 1
domestic guinea pig(100735121) regulator of G-protein signaling like 1
cow(509065) regulator of G-protein signaling like 1
cow(538868) regulator of G-protein signaling like 1
sheep(101103253) regulator of G-protein signaling like 1
chicken(429067) regulator of G-protein signaling like 1
Horse(100054900) regulator of G-protein signaling like 1
dog(490309) regulator of G-protein signaling like 1
dog(610504) regulator of G-protein signaling like 1
domestic cat(101101357) regulator of G-protein signaling like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181572 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181572 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181572 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181572 Rosetta Predictions human pricing
XM_001721759 Rosetta Predictions human pricing
XM_001725941 Rosetta Predictions human pricing
XM_001726587 Rosetta Predictions human pricing
XM_001073323 Rosetta Predictions rat pricing
XM_001479064 Rosetta Predictions mouse pricing
XM_890751 Rosetta Predictions mouse pricing
XM_994482 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247231 predicted 1355
2 SASI_Hs01_00247232 predicted 936
3 SASI_Hs01_00247233 predicted 1059
4 SASI_Hs01_00247234 predicted 681
5 SASI_Hs01_00247235 predicted 688
6 SASI_Hs01_00247236 predicted 964
7 SASI_Hs01_00247237 predicted 407
8 SASI_Hs01_00247238 predicted 798
9 SASI_Hs01_00247239 predicted 1592
10 SASI_Hs01_00247240 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00444866 predicted 1765
2 SASI_Hs02_00444867 predicted 3013
3 SASI_Hs02_00444868 predicted 1483
4 SASI_Hs02_00444869 predicted 2608
5 SASI_Hs02_00444870 predicted 247
6 SASI_Hs02_00444871 predicted 2634
7 SASI_Hs02_00444872 predicted 1743
8 SASI_Hs02_00444873 predicted 1328
9 SASI_Hs02_00444874 predicted 858
10 SASI_Hs02_00444875 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00470965 predicted 1769
2 SASI_Hs02_00470966 predicted 3015
3 SASI_Hs02_00470967 predicted 1484
4 SASI_Hs02_00470968 predicted 2614
5 SASI_Hs02_00470969 predicted 244
6 SASI_Hs02_00470970 predicted 2634
7 SASI_Hs02_00470971 predicted 1746
8 SASI_Hs02_00470972 predicted 1329
9 SASI_Hs02_00470973 predicted 861
10 SASI_Hs02_00470974 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00475194 predicted 1772
2 SASI_Hs02_00475195 predicted 3016
3 SASI_Hs02_00475196 predicted 1476
4 SASI_Hs02_00475197 predicted 2609
5 SASI_Hs02_00475198 predicted 243
6 SASI_Hs02_00475199 predicted 2633
7 SASI_Hs02_00475200 predicted 1745
8 SASI_Hs02_00475201 predicted 1325
9 SASI_Hs02_00475202 predicted 859
10 SASI_Hs02_00475203 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073323 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342403 predicted 628
2 SASI_Rn02_00342404 predicted 216
3 SASI_Rn02_00342405 predicted 332
4 SASI_Rn02_00342406 predicted 312
5 SASI_Rn02_00342407 predicted 360
6 SASI_Rn02_00342408 predicted 368
7 SASI_Rn02_00342409 predicted 856
8 SASI_Rn02_00342410 predicted 567
9 SASI_Rn02_00342411 predicted 216
10 SASI_Rn02_00342412 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479064 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00407349 predicted 2886
2 SASI_Mm02_00407350 predicted 258
3 SASI_Mm02_00407351 predicted 1397
4 SASI_Mm02_00407352 predicted 1906
5 SASI_Mm02_00407353 predicted 2753
6 SASI_Mm02_00407354 predicted 2747
7 SASI_Mm02_00407355 predicted 905
8 SASI_Mm02_00407356 predicted 1852
9 SASI_Mm02_00407357 predicted 2209
10 SASI_Mm02_00407358 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_890751 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215053 predicted 1112
2 SASI_Mm01_00215054 predicted 1449
3 SASI_Mm01_00215055 predicted 975
4 SASI_Mm01_00215056 predicted 1128
5 SASI_Mm01_00215057 predicted 1163
6 SASI_Mm01_00215058 predicted 1230
7 SASI_Mm01_00215059 predicted 1075
8 SASI_Mm01_00215060 predicted 1322
9 SASI_Mm01_00215061 predicted 1189
10 SASI_Mm01_00215062 predicted 1173
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994482 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00451780 predicted 2878
2 SASI_Mm02_00451781 predicted 2968
3 SASI_Mm02_00451782 predicted 254
4 SASI_Mm01_00243033 predicted 1397
5 SASI_Mm02_00451783 predicted 2753
6 SASI_Mm02_00451784 predicted 2745
7 SASI_Mm01_00243036 predicted 910
8 SASI_Mm01_00243038 predicted 1145
9 SASI_Mm02_00451785 predicted 2828
10 SASI_Mm01_00243040 predicted 994
11 SASI_Mm01_00243032 predicted 1836
12 SASI_Mm01_00243034 predicted 1888
13 SASI_Mm01_00243035 predicted 1863
14 SASI_Mm01_00243037 predicted 1837
15 SASI_Mm01_00243039 predicted 869
16 SASI_Mm01_00243041 predicted 1163
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181572
RGSL1 MISSION shRNA Bacterial Glycerol Stock
regulator of G-protein signaling like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181572.2-1058s1c1
Sequence:CCGGCGGGCATATAATGAGAATGATCTCGAGATCATTCTCATTATATGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181572.2-927s1c1
Sequence:CCGGCCCTTGTAAAGCGTCGTATATCTCGAGATATACGACGCTTTACAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181572.2-259s1c1
Sequence:CCGGGCCATCAATGAGACCCAGAAACTCGAGTTTCTGGGTCTCATTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181572.2-1348s1c1
Sequence:CCGGCCCTCCTAAATCTACGGACAACTCGAGTTGTCCGTAGATTTAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181572.2-1593s1c1
Sequence:CCGGGCAGAGATAAATCATCTCTTACTCGAGTAAGAGATGATTTATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181572
RGSL1 MISSION shRNA shRNA Plasmid DNA
regulator of G-protein signaling like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181572.2-1058s1c1
Sequence:CCGGCGGGCATATAATGAGAATGATCTCGAGATCATTCTCATTATATGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181572.2-927s1c1
Sequence:CCGGCCCTTGTAAAGCGTCGTATATCTCGAGATATACGACGCTTTACAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181572.2-259s1c1
Sequence:CCGGGCCATCAATGAGACCCAGAAACTCGAGTTTCTGGGTCTCATTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181572.2-1348s1c1
Sequence:CCGGCCCTCCTAAATCTACGGACAACTCGAGTTGTCCGTAGATTTAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181572.2-1593s1c1
Sequence:CCGGGCAGAGATAAATCATCTCTTACTCGAGTAAGAGATGATTTATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181572
RGSL1 MISSION shRNA Lentiviral Transduction Particles
regulator of G-protein signaling like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181572.2-1058s1c1
Sequence:CCGGCGGGCATATAATGAGAATGATCTCGAGATCATTCTCATTATATGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181572.2-927s1c1
Sequence:CCGGCCCTTGTAAAGCGTCGTATATCTCGAGATATACGACGCTTTACAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181572.2-259s1c1
Sequence:CCGGGCCATCAATGAGACCCAGAAACTCGAGTTTCTGGGTCTCATTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181572.2-1348s1c1
Sequence:CCGGCCCTCCTAAATCTACGGACAACTCGAGTTGTCCGTAGATTTAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181572.2-1593s1c1
Sequence:CCGGGCAGAGATAAATCATCTCTTACTCGAGTAAGAGATGATTTATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)