EMAIL THIS PAGE TO A FRIEND

RHBDD1

rhomboid domain containing 1

99 Gene Product Result for
Synonyms: RRP4
Gene ID:
Mouse(76867) rhomboid domain containing 1
Rat(316557) rhomboid domain containing 1
Zebrafish(550277) rhomboid domain containing 1
chicken(424800) rhomboid domain containing 1
dog(486149) rhomboid domain containing 1
domestic cat(101091221) rhomboid domain containing 1
cow(533985) rhomboid domain containing 1
sheep(101102542) rhomboid domain containing 1
naked mole-rat(101710681) rhomboid domain containing 1
domestic guinea pig(100716664) rhomboid domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032276 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032276 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032276 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029777 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029777 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029777 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032276 Rosetta Predictions human pricing
NM_001024891 Rosetta Predictions rat pricing
NM_001122685 Rosetta Predictions mouse pricing
NM_029777 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129866 predicted 834
2 SASI_Hs01_00129867 predicted 468
3 SASI_Hs02_00359593 predicted 237
4 SASI_Hs01_00129871 predicted 706
5 SASI_Hs01_00129873 predicted 418
6 SASI_Hs01_00129874 predicted 340
7 SASI_Hs02_00359594 predicted 496
8 SASI_Hs02_00359595 predicted 214
9 SASI_Hs02_00359596 predicted 228
10 SASI_Hs02_00359597 predicted 755
11 SASI_Hs01_00129868 predicted 570
12 SASI_Hs01_00129869 predicted 650
13 SASI_Hs01_00129870 predicted 675
14 SASI_Hs01_00129872 predicted 621
15 SASI_Hs01_00129875 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024891 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036543 predicted 974
2 SASI_Rn01_00036544 predicted 775
3 SASI_Rn01_00036545 predicted 705
4 SASI_Rn01_00036546 predicted 645
5 SASI_Rn01_00036547 predicted 339
6 SASI_Rn01_00036548 predicted 439
7 SASI_Rn02_00202786 predicted 971
8 SASI_Rn01_00036551 predicted 349
9 SASI_Rn01_00036552 predicted 1026
10 SASI_Rn02_00202787 predicted 941
11 SASI_Rn01_00036549 predicted 401
12 SASI_Rn01_00036550 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309244 predicted 1187
2 SASI_Mm02_00309245 predicted 765
3 SASI_Mm02_00309246 predicted 1307
4 SASI_Mm02_00309247 predicted 690
5 SASI_Mm02_00309248 predicted 510
6 SASI_Mm02_00309249 predicted 1190
7 SASI_Mm02_00309250 predicted 1585
8 SASI_Mm02_00309251 predicted 1251
9 SASI_Mm02_00309252 predicted 506
10 SASI_Mm02_00309253 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029777 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335919 predicted 1009
2 SASI_Mm01_00020050 predicted 591
3 SASI_Mm01_00020051 predicted 1126
4 SASI_Mm01_00020053 predicted 506
5 SASI_Mm01_00020052 predicted 331
6 SASI_Mm02_00335920 predicted 1009
7 SASI_Mm02_00335921 predicted 1410
8 SASI_Mm02_00335922 predicted 1078
9 SASI_Mm02_00335923 predicted 330
10 SASI_Mm02_00335924 predicted 732
11 SASI_Mm01_00020047 predicted 803
12 SASI_Mm01_00020048 predicted 731
13 SASI_Mm01_00020049 predicted 1016
14 SASI_Mm01_00020054 predicted 1298
15 SASI_Mm01_00020055 predicted 494
16 SASI_Mm01_00020056 predicted 952
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032276
VALIDATED
RHBDD1 MISSION shRNA Bacterial Glycerol Stock
rhomboid domain containing 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032276.3-1144s21c1
Sequence:CCGGGCGGCTTCACAGATTCGATAGCTCGAGCTATCGAATCTGTGAAGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032276.3-560s21c1
Sequence:CCGGGTACTTACTGGAGTGGTATACCTCGAGGTATACCACTCCAGTAAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032276.3-757s21c1
Sequence:CCGGCGAACTTGTGGCTATTCATTTCTCGAGAAATGAATAGCCACAAGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032276.3-439s21c1
Sequence:CCGGCCTTCACCATGCTGATGATTGCTCGAGCAATCATCAGCATGGTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032276.3-1188s21c1
Sequence:CCGGGACATGGCCTATTCGTGTAATCTCGAGATTACACGAATAGGCCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032276.3-725s21c1
Sequence:CCGGTTTCCTGTACCGAACAGATTTCTCGAGAAATCTGTTCGGTACAGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032276.2-1417s1c1
Sequence:CCGGCGGGAAGATTAGTCCCTCATTCTCGAGAATGAGGGACTAATCTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_032276.2-710s1c1
Sequence:CCGGGCTGGGATTCTTGTTGGACTACTCGAGTAGTCCAACAAGAATCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_032276.2-805s1c1
Sequence:CCGGAGGACGGCAATACTACTTTAACTCGAGTTAAAGTAGTATTGCCGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032276.2-837s1c1
Sequence:CCGGGCTCTGGATATCAGGATTATTCTCGAGAATAATCCTGATATCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032276.2-434s1c1
Sequence:CCGGGCCTATGTTATCACCGCATTTCTCGAGAAATGCGGTGATAACATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032276
VALIDATED
RHBDD1 MISSION shRNA shRNA Plasmid DNA
rhomboid domain containing 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032276.3-1144s21c1
Sequence:CCGGGCGGCTTCACAGATTCGATAGCTCGAGCTATCGAATCTGTGAAGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032276.3-560s21c1
Sequence:CCGGGTACTTACTGGAGTGGTATACCTCGAGGTATACCACTCCAGTAAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032276.3-757s21c1
Sequence:CCGGCGAACTTGTGGCTATTCATTTCTCGAGAAATGAATAGCCACAAGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032276.3-439s21c1
Sequence:CCGGCCTTCACCATGCTGATGATTGCTCGAGCAATCATCAGCATGGTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032276.3-1188s21c1
Sequence:CCGGGACATGGCCTATTCGTGTAATCTCGAGATTACACGAATAGGCCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032276.3-725s21c1
Sequence:CCGGTTTCCTGTACCGAACAGATTTCTCGAGAAATCTGTTCGGTACAGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032276.2-1417s1c1
Sequence:CCGGCGGGAAGATTAGTCCCTCATTCTCGAGAATGAGGGACTAATCTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_032276.2-710s1c1
Sequence:CCGGGCTGGGATTCTTGTTGGACTACTCGAGTAGTCCAACAAGAATCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_032276.2-805s1c1
Sequence:CCGGAGGACGGCAATACTACTTTAACTCGAGTTAAAGTAGTATTGCCGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032276.2-837s1c1
Sequence:CCGGGCTCTGGATATCAGGATTATTCTCGAGAATAATCCTGATATCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032276.2-434s1c1
Sequence:CCGGGCCTATGTTATCACCGCATTTCTCGAGAAATGCGGTGATAACATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032276
VALIDATED
RHBDD1 MISSION shRNA Lentiviral Transduction Particles
rhomboid domain containing 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032276.3-1144s21c1
Sequence:CCGGGCGGCTTCACAGATTCGATAGCTCGAGCTATCGAATCTGTGAAGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032276.3-560s21c1
Sequence:CCGGGTACTTACTGGAGTGGTATACCTCGAGGTATACCACTCCAGTAAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032276.3-757s21c1
Sequence:CCGGCGAACTTGTGGCTATTCATTTCTCGAGAAATGAATAGCCACAAGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032276.3-439s21c1
Sequence:CCGGCCTTCACCATGCTGATGATTGCTCGAGCAATCATCAGCATGGTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032276.3-1188s21c1
Sequence:CCGGGACATGGCCTATTCGTGTAATCTCGAGATTACACGAATAGGCCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032276.3-725s21c1
Sequence:CCGGTTTCCTGTACCGAACAGATTTCTCGAGAAATCTGTTCGGTACAGGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032276.2-1417s1c1
Sequence:CCGGCGGGAAGATTAGTCCCTCATTCTCGAGAATGAGGGACTAATCTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_032276.2-710s1c1
Sequence:CCGGGCTGGGATTCTTGTTGGACTACTCGAGTAGTCCAACAAGAATCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_032276.2-805s1c1
Sequence:CCGGAGGACGGCAATACTACTTTAACTCGAGTTAAAGTAGTATTGCCGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032276.2-837s1c1
Sequence:CCGGGCTCTGGATATCAGGATTATTCTCGAGAATAATCCTGATATCCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032276.2-434s1c1
Sequence:CCGGGCCTATGTTATCACCGCATTTCTCGAGAAATGCGGTGATAACATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029777
VALIDATED
RHBDD1 MISSION shRNA Bacterial Glycerol Stock
rhomboid domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029777.3-1068s21c1
Sequence:CCGGCAGCGTCTTCACAGATTTGATCTCGAGATCAAATCTGTGAAGACGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029777.3-625s21c1
Sequence:CCGGCCGGAGGCTTTGTCAACATTTCTCGAGAAATGTTGACAAAGCCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029777.3-194s21c1
Sequence:CCGGCCTCTCTCAAGTGTTCCAAATCTCGAGATTTGGAACACTTGAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029777.3-599s21c1
Sequence:CCGGGAAAGTTCTTAGCAACCATTACTCGAGTAATGGTTGCTAAGAACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331447    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029777.3-1416s21c1
Sequence:CCGGGGTAAAGCCTGGGCCCTTAATCTCGAGATTAAGGGCCCAGGCTTTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029777.2-565s1c1
Sequence:CCGGCCGGAGGCTTTGTCAACATTTCTCGAGAAATGTTGACAAAGCCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029777.2-323s1c1
Sequence:CCGGCTGGCATTTGTATTTCAACATCTCGAGATGTTGAAATACAAATGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029777.2-1008s1c1
Sequence:CCGGCAGCGTCTTCACAGATTTGATCTCGAGATCAAATCTGTGAAGACGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029777.2-134s1c1
Sequence:CCGGCCTCTCTCAAGTGTTCCAAATCTCGAGATTTGGAACACTTGAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029777.2-539s1c1
Sequence:CCGGGAAAGTTCTTAGCAACCATTACTCGAGTAATGGTTGCTAAGAACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029777
VALIDATED
RHBDD1 MISSION shRNA shRNA Plasmid DNA
rhomboid domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029777.3-1068s21c1
Sequence:CCGGCAGCGTCTTCACAGATTTGATCTCGAGATCAAATCTGTGAAGACGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029777.3-625s21c1
Sequence:CCGGCCGGAGGCTTTGTCAACATTTCTCGAGAAATGTTGACAAAGCCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029777.3-194s21c1
Sequence:CCGGCCTCTCTCAAGTGTTCCAAATCTCGAGATTTGGAACACTTGAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029777.3-599s21c1
Sequence:CCGGGAAAGTTCTTAGCAACCATTACTCGAGTAATGGTTGCTAAGAACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331447    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029777.3-1416s21c1
Sequence:CCGGGGTAAAGCCTGGGCCCTTAATCTCGAGATTAAGGGCCCAGGCTTTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029777.2-565s1c1
Sequence:CCGGCCGGAGGCTTTGTCAACATTTCTCGAGAAATGTTGACAAAGCCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029777.2-323s1c1
Sequence:CCGGCTGGCATTTGTATTTCAACATCTCGAGATGTTGAAATACAAATGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029777.2-1008s1c1
Sequence:CCGGCAGCGTCTTCACAGATTTGATCTCGAGATCAAATCTGTGAAGACGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029777.2-134s1c1
Sequence:CCGGCCTCTCTCAAGTGTTCCAAATCTCGAGATTTGGAACACTTGAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029777.2-539s1c1
Sequence:CCGGGAAAGTTCTTAGCAACCATTACTCGAGTAATGGTTGCTAAGAACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029777
VALIDATED
RHBDD1 MISSION shRNA Lentiviral Transduction Particles
rhomboid domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029777.3-1068s21c1
Sequence:CCGGCAGCGTCTTCACAGATTTGATCTCGAGATCAAATCTGTGAAGACGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029777.3-625s21c1
Sequence:CCGGCCGGAGGCTTTGTCAACATTTCTCGAGAAATGTTGACAAAGCCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029777.3-194s21c1
Sequence:CCGGCCTCTCTCAAGTGTTCCAAATCTCGAGATTTGGAACACTTGAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029777.3-599s21c1
Sequence:CCGGGAAAGTTCTTAGCAACCATTACTCGAGTAATGGTTGCTAAGAACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331447    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029777.3-1416s21c1
Sequence:CCGGGGTAAAGCCTGGGCCCTTAATCTCGAGATTAAGGGCCCAGGCTTTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029777.2-565s1c1
Sequence:CCGGCCGGAGGCTTTGTCAACATTTCTCGAGAAATGTTGACAAAGCCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029777.2-323s1c1
Sequence:CCGGCTGGCATTTGTATTTCAACATCTCGAGATGTTGAAATACAAATGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029777.2-1008s1c1
Sequence:CCGGCAGCGTCTTCACAGATTTGATCTCGAGATCAAATCTGTGAAGACGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029777.2-134s1c1
Sequence:CCGGCCTCTCTCAAGTGTTCCAAATCTCGAGATTTGGAACACTTGAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029777.2-539s1c1
Sequence:CCGGGAAAGTTCTTAGCAACCATTACTCGAGTAATGGTTGCTAAGAACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)