EMAIL THIS PAGE TO A FRIEND

RHBDF1P1

rhomboid 5 homolog 1 (Drosophila) pseudogene 1

Gene Product Result for
Species: Human RHBDF1P1(131973)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_497912
RHBDF1P1 MISSION shRNA Bacterial Glycerol Stock
rhomboid 5 homolog 1 (Drosophila) pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497912.1-2043s1c1
Sequence:CCGGGTACTGGAAATGCTGCCTGATCTCGAGATCAGGCAGCATTTCCAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497912.1-322s1c1
Sequence:CCGGCTGATGAAAGGCTGCTCGATTCTCGAGAATCGAGCAGCCTTTCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497912.1-955s1c1
Sequence:CCGGCATGAAACGATGGACTCGATTCTCGAGAATCGAGTCCATCGTTTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497912.1-408s1c1
Sequence:CCGGCACGAATTTCCCTGATGAGATCTCGAGATCTCATCAGGGAAATTCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497912.1-2025s1c1
Sequence:CCGGCTTCAGCAAGTTCCATCTGTACTCGAGTACAGATGGAACTTGCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_497912
RHBDF1P1 MISSION shRNA shRNA Plasmid DNA
rhomboid 5 homolog 1 (Drosophila) pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497912.1-2043s1c1
Sequence:CCGGGTACTGGAAATGCTGCCTGATCTCGAGATCAGGCAGCATTTCCAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497912.1-322s1c1
Sequence:CCGGCTGATGAAAGGCTGCTCGATTCTCGAGAATCGAGCAGCCTTTCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497912.1-955s1c1
Sequence:CCGGCATGAAACGATGGACTCGATTCTCGAGAATCGAGTCCATCGTTTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497912.1-408s1c1
Sequence:CCGGCACGAATTTCCCTGATGAGATCTCGAGATCTCATCAGGGAAATTCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497912.1-2025s1c1
Sequence:CCGGCTTCAGCAAGTTCCATCTGTACTCGAGTACAGATGGAACTTGCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_497912
RHBDF1P1 MISSION shRNA Lentiviral Transduction Particles
rhomboid 5 homolog 1 (Drosophila) pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497912.1-2043s1c1
Sequence:CCGGGTACTGGAAATGCTGCCTGATCTCGAGATCAGGCAGCATTTCCAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497912.1-322s1c1
Sequence:CCGGCTGATGAAAGGCTGCTCGATTCTCGAGAATCGAGCAGCCTTTCATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497912.1-955s1c1
Sequence:CCGGCATGAAACGATGGACTCGATTCTCGAGAATCGAGTCCATCGTTTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497912.1-408s1c1
Sequence:CCGGCACGAATTTCCCTGATGAGATCTCGAGATCTCATCAGGGAAATTCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497912.1-2025s1c1
Sequence:CCGGCTTCAGCAAGTTCCATCTGTACTCGAGTACAGATGGAACTTGCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)