EMAIL THIS PAGE TO A FRIEND

RHBDF2

rhomboid 5 homolog 2 (Drosophila)

56 Gene Product Result for
Synonyms: RHBDL5 RHBDL6 TOC
UniProtKB ID: Q6PJF5, A6NEM3, A8K801, Q5U607, Q5YGQ8, Q9H6E9
Gene ID:
Mouse(217344) rhomboid 5 homolog 2 (Drosophila)
Rat(303690) rhomboid 5 homolog 2 (Drosophila)
chicken(417358) rhomboid 5 homolog 2 (Drosophila)
domestic cat(101098418) rhomboid 5 homolog 2 (Drosophila)
dog(483332) rhomboid 5 homolog 2 (Drosophila)
cow(517903) rhomboid 5 homolog 2 (Drosophila)
sheep(101104587) rhomboid 5 homolog 2 (Drosophila)
naked mole-rat(101714240) rhomboid 5 homolog 2 (Drosophila)
domestic guinea pig(100724517) rhomboid 5 homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024599 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024599 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024599 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172572 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172572 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172572 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005498 Rosetta Predictions human pricing
NM_024599 Rosetta Predictions human pricing
NM_001107067 Rosetta Predictions rat pricing
NM_172572 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080635 predicted 1105
2 SASI_Hs01_00080636 predicted 1274
3 SASI_Hs01_00080637 predicted 1532
4 SASI_Hs01_00080639 predicted 1959
5 SASI_Hs01_00080640 predicted 1422
6 SASI_Hs02_00304964 predicted 2268
7 SASI_Hs01_00080641 predicted 2149
8 SASI_Hs02_00304965 predicted 2210
9 SASI_Hs01_00080642 predicted 1967
10 SASI_Hs01_00080644 predicted 1736
11 SASI_Hs01_00080638 predicted 750
12 SASI_Hs01_00080643 predicted 2611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072430 predicted 1187
2 SASI_Hs01_00072431 predicted 1365
3 SASI_Hs01_00072432 predicted 1618
4 SASI_Hs01_00072434 predicted 2045
5 SASI_Hs01_00072435 predicted 1507
6 SASI_Hs02_00356949 predicted 2359
7 SASI_Hs01_00072436 predicted 2241
8 SASI_Hs02_00356950 predicted 2299
9 SASI_Hs01_00072437 predicted 2052
10 SASI_Hs01_00072439 predicted 1829
11 SASI_Hs01_00072433 predicted 834
12 SASI_Hs01_00072438 predicted 2706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107067 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225166 predicted 1660
2 SASI_Rn02_00225167 predicted 1897
3 SASI_Rn02_00225168 predicted 1285
4 SASI_Rn02_00225169 predicted 1543
5 SASI_Rn02_00225170 predicted 2438
6 SASI_Rn02_00225171 predicted 1099
7 SASI_Rn02_00225172 predicted 1464
8 SASI_Rn02_00225173 predicted 1305
9 SASI_Rn02_00225174 predicted 1144
10 SASI_Rn02_00225175 predicted 2501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172572 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108340 predicted 1129
2 SASI_Mm01_00108341 predicted 1506
3 SASI_Mm01_00108342 predicted 979
4 SASI_Mm01_00108343 predicted 1984
5 SASI_Mm01_00108344 predicted 966
6 SASI_Mm01_00108345 predicted 1998
7 SASI_Mm02_00344237 predicted 2325
8 SASI_Mm01_00108346 predicted 1747
9 SASI_Mm01_00108347 predicted 2258
10 SASI_Mm01_00108348 predicted 1823
11 SASI_Mm01_00108349 predicted 1766
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024599
VALIDATED
RHBDF2 MISSION shRNA Bacterial Glycerol Stock
rhomboid 5 homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024599.2-1133s1c1
Sequence:CCGGGACACGTTTGACTCCTCCTTTCTCGAGAAAGGAGGAGTCAAACGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024599.2-1343s1c1
Sequence:CCGGGTGAAGCACTTTGCCTTTGATCTCGAGATCAAAGGCAAAGTGCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024599.2-2132s1c1
Sequence:CCGGCACGGCTATTTCCATGAGGAACTCGAGTTCCTCATGGAAATAGCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024599.3-1290s21c1
Sequence:CCGGCAAATCCCTCTGAAGGAGTATCTCGAGATACTCCTTCAGAGGGATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024599.2-1271s1c1
Sequence:CCGGCAAATCCCTCTGAAGGAGTATCTCGAGATACTCCTTCAGAGGGATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024599.3-3022s21c1
Sequence:CCGGCCGCGTGAGATGGTTGGTTAACTCGAGTTAACCAACCATCTCACGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024599.3-2151s21c1
Sequence:CCGGCACGGCTATTTCCATGAGGAACTCGAGTTCCTCATGGAAATAGCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024599.3-2304s21c1
Sequence:CCGGCTCGTGTCTGTGGTCTTTCAACTCGAGTTGAAAGACCACAGACACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024599.3-1362s21c1
Sequence:CCGGGTGAAGCACTTTGCCTTTGATCTCGAGATCAAAGGCAAAGTGCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024599
VALIDATED
RHBDF2 MISSION shRNA shRNA Plasmid DNA
rhomboid 5 homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024599.2-1133s1c1
Sequence:CCGGGACACGTTTGACTCCTCCTTTCTCGAGAAAGGAGGAGTCAAACGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024599.2-1343s1c1
Sequence:CCGGGTGAAGCACTTTGCCTTTGATCTCGAGATCAAAGGCAAAGTGCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024599.2-2132s1c1
Sequence:CCGGCACGGCTATTTCCATGAGGAACTCGAGTTCCTCATGGAAATAGCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024599.3-1290s21c1
Sequence:CCGGCAAATCCCTCTGAAGGAGTATCTCGAGATACTCCTTCAGAGGGATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024599.2-1271s1c1
Sequence:CCGGCAAATCCCTCTGAAGGAGTATCTCGAGATACTCCTTCAGAGGGATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024599.3-3022s21c1
Sequence:CCGGCCGCGTGAGATGGTTGGTTAACTCGAGTTAACCAACCATCTCACGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024599.3-2151s21c1
Sequence:CCGGCACGGCTATTTCCATGAGGAACTCGAGTTCCTCATGGAAATAGCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024599.3-2304s21c1
Sequence:CCGGCTCGTGTCTGTGGTCTTTCAACTCGAGTTGAAAGACCACAGACACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024599.3-1362s21c1
Sequence:CCGGGTGAAGCACTTTGCCTTTGATCTCGAGATCAAAGGCAAAGTGCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024599
VALIDATED
RHBDF2 MISSION shRNA Lentiviral Transduction Particles
rhomboid 5 homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024599.2-1133s1c1
Sequence:CCGGGACACGTTTGACTCCTCCTTTCTCGAGAAAGGAGGAGTCAAACGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024599.2-1343s1c1
Sequence:CCGGGTGAAGCACTTTGCCTTTGATCTCGAGATCAAAGGCAAAGTGCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024599.2-2132s1c1
Sequence:CCGGCACGGCTATTTCCATGAGGAACTCGAGTTCCTCATGGAAATAGCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024599.3-1290s21c1
Sequence:CCGGCAAATCCCTCTGAAGGAGTATCTCGAGATACTCCTTCAGAGGGATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024599.2-1271s1c1
Sequence:CCGGCAAATCCCTCTGAAGGAGTATCTCGAGATACTCCTTCAGAGGGATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024599.3-3022s21c1
Sequence:CCGGCCGCGTGAGATGGTTGGTTAACTCGAGTTAACCAACCATCTCACGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024599.3-2151s21c1
Sequence:CCGGCACGGCTATTTCCATGAGGAACTCGAGTTCCTCATGGAAATAGCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024599.3-2304s21c1
Sequence:CCGGCTCGTGTCTGTGGTCTTTCAACTCGAGTTGAAAGACCACAGACACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024599.3-1362s21c1
Sequence:CCGGGTGAAGCACTTTGCCTTTGATCTCGAGATCAAAGGCAAAGTGCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172572
VALIDATED
RHBDF2 MISSION shRNA Bacterial Glycerol Stock
rhomboid 5 homolog 2 (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172572.1-1498s1c1
Sequence:CCGGGCCTCCAAAGTAAAGCACTTTCTCGAGAAAGTGCTTTACTTTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172572.1-2202s1c1
Sequence:CCGGGCACATAGACTGTAAGATCAACTCGAGTTGATCTTACAGTCTATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172572.1-3142s1c1
Sequence:CCGGCCTCCTTTCTCAGGTCTGAATCTCGAGATTCAGACCTGAGAAAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172572.1-1659s1c1
Sequence:CCGGGCTGACGTTCGTTCACATCATCTCGAGATGATGTGAACGAACGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172572.1-970s1c1
Sequence:CCGGCCGTGCAAGATGCCCAAGATTCTCGAGAATCTTGGGCATCTTGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172572.3-1819s21c1
Sequence:CCGGCCAGCTCGATTGACCTCATTCCTCGAGGAATGAGGTCAATCGAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172572.3-2128s21c1
Sequence:CCGGACATCTGGCCTGATGACATTACTCGAGTAATGTCATCAGGCCAGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172572.3-1233s21c1
Sequence:CCGGGTCAAACGCAGCTTCGCTTACCTCGAGGTAAGCGAAGCTGCGTTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172572
VALIDATED
RHBDF2 MISSION shRNA shRNA Plasmid DNA
rhomboid 5 homolog 2 (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172572.1-1498s1c1
Sequence:CCGGGCCTCCAAAGTAAAGCACTTTCTCGAGAAAGTGCTTTACTTTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172572.1-2202s1c1
Sequence:CCGGGCACATAGACTGTAAGATCAACTCGAGTTGATCTTACAGTCTATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172572.1-3142s1c1
Sequence:CCGGCCTCCTTTCTCAGGTCTGAATCTCGAGATTCAGACCTGAGAAAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172572.1-1659s1c1
Sequence:CCGGGCTGACGTTCGTTCACATCATCTCGAGATGATGTGAACGAACGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172572.1-970s1c1
Sequence:CCGGCCGTGCAAGATGCCCAAGATTCTCGAGAATCTTGGGCATCTTGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172572.3-1819s21c1
Sequence:CCGGCCAGCTCGATTGACCTCATTCCTCGAGGAATGAGGTCAATCGAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172572.3-2128s21c1
Sequence:CCGGACATCTGGCCTGATGACATTACTCGAGTAATGTCATCAGGCCAGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172572.3-1233s21c1
Sequence:CCGGGTCAAACGCAGCTTCGCTTACCTCGAGGTAAGCGAAGCTGCGTTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172572
VALIDATED
RHBDF2 MISSION shRNA Lentiviral Transduction Particles
rhomboid 5 homolog 2 (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172572.1-1498s1c1
Sequence:CCGGGCCTCCAAAGTAAAGCACTTTCTCGAGAAAGTGCTTTACTTTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172572.1-2202s1c1
Sequence:CCGGGCACATAGACTGTAAGATCAACTCGAGTTGATCTTACAGTCTATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172572.1-3142s1c1
Sequence:CCGGCCTCCTTTCTCAGGTCTGAATCTCGAGATTCAGACCTGAGAAAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172572.1-1659s1c1
Sequence:CCGGGCTGACGTTCGTTCACATCATCTCGAGATGATGTGAACGAACGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172572.1-970s1c1
Sequence:CCGGCCGTGCAAGATGCCCAAGATTCTCGAGAATCTTGGGCATCTTGCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172572.3-1819s21c1
Sequence:CCGGCCAGCTCGATTGACCTCATTCCTCGAGGAATGAGGTCAATCGAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172572.3-2128s21c1
Sequence:CCGGACATCTGGCCTGATGACATTACTCGAGTAATGTCATCAGGCCAGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172572.3-1233s21c1
Sequence:CCGGGTCAAACGCAGCTTCGCTTACCTCGAGGTAAGCGAAGCTGCGTTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)