EMAIL THIS PAGE TO A FRIEND

RHBDL1

rhomboid, veinlet-like 1 (Drosophila)

62 Gene Product Result for
Synonyms: RHBDL RRP
UniProtKB ID: O75783, A2IDC0, A2IDC1, Q0VAX4, Q9NQ85
Gene ID:
Human(9028) Summary: This gene encodes a protein similar to Rhomboid in Drosophila which is involved in signalling in the Spitz/epidermal growth factor receptor/mitogen-activated protein kinase pathway. The Rhomboid family of proteins consists of intramembrane serine proteases containing several transmembrane domains. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Mouse(214951) rhomboid, veinlet-like 1 (Drosophila)
Rat(117025) rhomboid, veinlet-like 1 (Drosophila)
domestic guinea pig(100717046) rhomboid, veinlet-like 1 (Drosophila)
naked mole-rat(101700571) rhomboid, veinlet-like 1 (Drosophila)
cow(100336895) rhomboid, veinlet-like 1 (Drosophila)
sheep(101110639) rhomboid, veinlet-like 1 (Drosophila)
Zebrafish(100887821) rhomboid, veinlet-like 1 (Drosophila)
domestic cat(101093071) rhomboid, veinlet-like 1 (Drosophila)
Horse(100066958) rhomboid, veinlet-like 1 (Drosophila)
dog(490092) rhomboid, veinlet-like 1 (Drosophila)
chicken(429205) rhomboid, veinlet-like 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144816 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144816 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144816 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003961 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003961 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003961 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003961 Rosetta Predictions human pricing
XM_001060539 Rosetta Predictions rat pricing
XM_340773 Rosetta Predictions rat pricing
NM_144816 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184770 predicted 636
2 SASI_Hs01_00184771 predicted 1028
3 SASI_Hs01_00184772 predicted 613
4 SASI_Hs02_00336638 predicted 277
5 SASI_Hs01_00184773 predicted 636
6 SASI_Hs01_00184774 predicted 301
7 SASI_Hs01_00184775 predicted 279
8 SASI_Hs02_00336639 predicted 1261
9 SASI_Hs01_00184776 predicted 634
10 SASI_Hs01_00184777 predicted 579
11 SASI_Hs01_00184778 predicted 985
12 SASI_Hs01_00184779 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060539 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296932 predicted 974
2 SASI_Rn02_00296933 predicted 855
3 SASI_Rn02_00296934 predicted 1226
4 SASI_Rn02_00296935 predicted 864
5 SASI_Rn02_00296936 predicted 956
6 SASI_Rn02_00296937 predicted 1346
7 SASI_Rn02_00296938 predicted 586
8 SASI_Rn02_00296939 predicted 753
9 SASI_Rn02_00296940 predicted 461
10 SASI_Rn02_00296941 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340773 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391879 predicted 305
2 SASI_Rn02_00391880 predicted 390
3 SASI_Rn02_00391881 predicted 224
4 SASI_Rn02_00391882 predicted 238
5 SASI_Rn02_00391883 predicted 242
6 SASI_Rn02_00391884 predicted 222
7 SASI_Rn02_00391885 predicted 245
8 SASI_Rn02_00391886 predicted 313
9 SASI_Rn02_00391887 predicted 288
10 SASI_Rn02_00391888 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144816 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025718 predicted 904
2 SASI_Mm01_00025719 predicted 579
3 SASI_Mm01_00025720 predicted 496
4 SASI_Mm01_00025721 predicted 518
5 SASI_Mm01_00025722 predicted 1120
6 SASI_Mm02_00340175 predicted 228
7 SASI_Mm01_00025724 predicted 416
8 SASI_Mm01_00025725 predicted 861
9 SASI_Mm01_00025726 predicted 385
10 SASI_Mm01_00025727 predicted 296
11 SASI_Mm01_00025723 predicted 516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144816
RHBDL1 MISSION shRNA Bacterial Glycerol Stock
rhomboid, veinlet-like 1 (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144816.1-739s21c1
Sequence:CCGGTACATGGCGTGCTTCGCATCACTCGAGTGATGCGAAGCACGCCATGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144816.1-899s21c1
Sequence:CCGGTGGGATGCGGTGTCCATACAACTCGAGTTGTATGGACACCGCATCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144816.1-403s21c1
Sequence:CCGGACAAGCGGTTTGTGCGCTATGCTCGAGCATAGCGCACAAACCGCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144816.1-1279s1c1
Sequence:CCGGGCCCTATATGAATGGACCTCTCTCGAGAGAGGTCCATTCATATAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144816.1-797s1c1
Sequence:CCGGGACTGTCTCTATCACAGATATCTCGAGATATCTGTGATAGAGACAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144816.1-1161s1c1
Sequence:CCGGGCCATCTTCTGGAACGTCTTTCTCGAGAAAGACGTTCCAGAAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144816.1-1071s1c1
Sequence:CCGGCTTACCATCCTTCGGAGCTATCTCGAGATAGCTCCGAAGGATGGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144816.1-576s1c1
Sequence:CCGGCAGACCTACCACCCTGAATATCTCGAGATATTCAGGGTGGTAGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144816
RHBDL1 MISSION shRNA shRNA Plasmid DNA
rhomboid, veinlet-like 1 (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144816.1-739s21c1
Sequence:CCGGTACATGGCGTGCTTCGCATCACTCGAGTGATGCGAAGCACGCCATGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144816.1-899s21c1
Sequence:CCGGTGGGATGCGGTGTCCATACAACTCGAGTTGTATGGACACCGCATCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144816.1-403s21c1
Sequence:CCGGACAAGCGGTTTGTGCGCTATGCTCGAGCATAGCGCACAAACCGCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144816.1-1279s1c1
Sequence:CCGGGCCCTATATGAATGGACCTCTCTCGAGAGAGGTCCATTCATATAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144816.1-797s1c1
Sequence:CCGGGACTGTCTCTATCACAGATATCTCGAGATATCTGTGATAGAGACAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144816.1-1161s1c1
Sequence:CCGGGCCATCTTCTGGAACGTCTTTCTCGAGAAAGACGTTCCAGAAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144816.1-1071s1c1
Sequence:CCGGCTTACCATCCTTCGGAGCTATCTCGAGATAGCTCCGAAGGATGGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144816.1-576s1c1
Sequence:CCGGCAGACCTACCACCCTGAATATCTCGAGATATTCAGGGTGGTAGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144816
RHBDL1 MISSION shRNA Lentiviral Transduction Particles
rhomboid, veinlet-like 1 (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144816.1-739s21c1
Sequence:CCGGTACATGGCGTGCTTCGCATCACTCGAGTGATGCGAAGCACGCCATGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144816.1-899s21c1
Sequence:CCGGTGGGATGCGGTGTCCATACAACTCGAGTTGTATGGACACCGCATCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144816.1-403s21c1
Sequence:CCGGACAAGCGGTTTGTGCGCTATGCTCGAGCATAGCGCACAAACCGCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144816.1-1279s1c1
Sequence:CCGGGCCCTATATGAATGGACCTCTCTCGAGAGAGGTCCATTCATATAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144816.1-797s1c1
Sequence:CCGGGACTGTCTCTATCACAGATATCTCGAGATATCTGTGATAGAGACAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144816.1-1161s1c1
Sequence:CCGGGCCATCTTCTGGAACGTCTTTCTCGAGAAAGACGTTCCAGAAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144816.1-1071s1c1
Sequence:CCGGCTTACCATCCTTCGGAGCTATCTCGAGATAGCTCCGAAGGATGGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144816.1-576s1c1
Sequence:CCGGCAGACCTACCACCCTGAATATCTCGAGATATTCAGGGTGGTAGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003961
RHBDL1 MISSION shRNA Bacterial Glycerol Stock
rhomboid, veinlet-like 1 (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003961.1-514s1c1
Sequence:CCGGCTAGGTGTCTACAAGCGGTTTCTCGAGAAACCGCTTGTAGACACCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003961.1-1032s1c1
Sequence:CCGGTCCCTACAAGTTGCTGAGGATCTCGAGATCCTCAGCAACTTGTAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003961.1-579s1c1
Sequence:CCGGCCGCTGGTACTTCTACCGTCACTCGAGTGACGGTAGAAGTACCAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003961.1-771s1c1
Sequence:CCGGCCTCACCTACATGTTCATGCACTCGAGTGCATGAACATGTAGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003961.1-1023s1c1
Sequence:CCGGGATGAGATGTCCCTACAAGTTCTCGAGAACTTGTAGGGACATCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003961
RHBDL1 MISSION shRNA shRNA Plasmid DNA
rhomboid, veinlet-like 1 (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003961.1-514s1c1
Sequence:CCGGCTAGGTGTCTACAAGCGGTTTCTCGAGAAACCGCTTGTAGACACCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003961.1-1032s1c1
Sequence:CCGGTCCCTACAAGTTGCTGAGGATCTCGAGATCCTCAGCAACTTGTAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003961.1-579s1c1
Sequence:CCGGCCGCTGGTACTTCTACCGTCACTCGAGTGACGGTAGAAGTACCAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003961.1-771s1c1
Sequence:CCGGCCTCACCTACATGTTCATGCACTCGAGTGCATGAACATGTAGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003961.1-1023s1c1
Sequence:CCGGGATGAGATGTCCCTACAAGTTCTCGAGAACTTGTAGGGACATCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003961
RHBDL1 MISSION shRNA Lentiviral Transduction Particles
rhomboid, veinlet-like 1 (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003961.1-514s1c1
Sequence:CCGGCTAGGTGTCTACAAGCGGTTTCTCGAGAAACCGCTTGTAGACACCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003961.1-1032s1c1
Sequence:CCGGTCCCTACAAGTTGCTGAGGATCTCGAGATCCTCAGCAACTTGTAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003961.1-579s1c1
Sequence:CCGGCCGCTGGTACTTCTACCGTCACTCGAGTGACGGTAGAAGTACCAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003961.1-771s1c1
Sequence:CCGGCCTCACCTACATGTTCATGCACTCGAGTGCATGAACATGTAGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003961.1-1023s1c1
Sequence:CCGGGATGAGATGTCCCTACAAGTTCTCGAGAACTTGTAGGGACATCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)