EMAIL THIS PAGE TO A FRIEND

RHBDL2

rhomboid, veinlet-like 2 (Drosophila)

67 Gene Product Result for
Synonyms: RRP2
UniProtKB ID: Q9NX52, B2RNT3, B9EH75, Q6P175, Q8NER8, Q96E02
Gene ID:
Human(54933) Summary: The protein encoded by this gene is a member of the rhomboid family of integral membrane proteins. This family contains proteins that are related to Drosophila rhomboid protein. Members of this family are found in both prokaryotes and eukaryotes and are thought to function as intramembrane serine proteases. The encoded protein is thought to release soluble growth factors by proteolytic cleavage of certain membrane-bound substrates, including ephrin B2 and ephrin B3. [provided by RefSeq, Jul 2008]
Mouse(230726) rhomboid, veinlet-like 2 (Drosophila)
Rat(298512) rhomboid, veinlet-like 2 (Drosophila)
Zebrafish(792002) rhomboid, veinlet-like 2 (Drosophila)
dog(482466) rhomboid, veinlet-like 2 (Drosophila)
domestic cat(101094436) rhomboid, veinlet-like 2 (Drosophila)
cow(514943) rhomboid, veinlet-like 2 (Drosophila)
sheep(101117975) rhomboid, veinlet-like 2 (Drosophila)
naked mole-rat(101707842) rhomboid, veinlet-like 2 (Drosophila)
domestic guinea pig(100716219) rhomboid, veinlet-like 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183163 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183163 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183163 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017821 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017821 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017821 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU152631 MISSION® esiRNA esiRNA targeting mouse Rhbdl2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017821 Rosetta Predictions human pricing
NM_001106684 Rosetta Predictions rat pricing
NM_183163 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171260 predicted 511
2 SASI_Hs01_00171261 predicted 401
3 SASI_Hs01_00171262 predicted 665
4 SASI_Hs01_00171263 predicted 795
5 SASI_Hs01_00171264 predicted 909
6 SASI_Hs01_00171265 predicted 580
7 SASI_Hs01_00171266 predicted 883
8 SASI_Hs01_00171267 predicted 577
9 SASI_Hs01_00171268 predicted 747
10 SASI_Hs01_00171269 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221368 predicted 324
2 SASI_Rn02_00221369 predicted 479
3 SASI_Rn02_00221370 predicted 391
4 SASI_Rn02_00221371 predicted 394
5 SASI_Rn02_00221372 predicted 528
6 SASI_Rn02_00221373 predicted 509
7 SASI_Rn02_00221374 predicted 541
8 SASI_Rn02_00221375 predicted 296
9 SASI_Rn02_00221376 predicted 364
10 SASI_Rn02_00221377 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183163 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350235 predicted 847
2 SASI_Mm02_00350236 predicted 462
3 SASI_Mm02_00350237 predicted 755
4 SASI_Mm02_00350238 predicted 894
5 SASI_Mm02_00350239 predicted 866
6 SASI_Mm02_00350240 predicted 791
7 SASI_Mm02_00350241 predicted 687
8 SASI_Mm02_00350242 predicted 951
9 SASI_Mm02_00350243 predicted 749
10 SASI_Mm02_00350244 predicted 956
11 SASI_Mm01_00125027 predicted 576
12 SASI_Mm01_00125028 predicted 750
13 SASI_Mm01_00125029 predicted 756
14 SASI_Mm01_00125030 predicted 813
15 SASI_Mm01_00125031 predicted 811
16 SASI_Mm01_00125032 predicted 586
17 SASI_Mm01_00125033 predicted 708
18 SASI_Mm01_00125034 predicted 501
19 SASI_Mm01_00125035 predicted 349
20 SASI_Mm01_00125036 predicted 786
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183163
RHBDL2 MISSION shRNA Bacterial Glycerol Stock
rhomboid, veinlet-like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183163.1-284s1c1
Sequence:CCGGGCCAGTCCGAAGAACATACTTCTCGAGAAGTATGTTCTTCGGACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183163.1-285s1c1
Sequence:CCGGCCAGTCCGAAGAACATACTTACTCGAGTAAGTATGTTCTTCGGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183163.1-1249s1c1
Sequence:CCGGCCCAGCAGAATTGAATCAATACTCGAGTATTGATTCAATTCTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183163.1-205s1c1
Sequence:CCGGTGAAAGGGAATGGAGAAGGTACTCGAGTACCTTCTCCATTCCCTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183163.1-347s1c1
Sequence:CCGGCATCAGTCTGGCTGAGGTAAACTCGAGTTTACCTCAGCCAGACTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183163
RHBDL2 MISSION shRNA shRNA Plasmid DNA
rhomboid, veinlet-like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183163.1-284s1c1
Sequence:CCGGGCCAGTCCGAAGAACATACTTCTCGAGAAGTATGTTCTTCGGACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183163.1-285s1c1
Sequence:CCGGCCAGTCCGAAGAACATACTTACTCGAGTAAGTATGTTCTTCGGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183163.1-1249s1c1
Sequence:CCGGCCCAGCAGAATTGAATCAATACTCGAGTATTGATTCAATTCTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183163.1-205s1c1
Sequence:CCGGTGAAAGGGAATGGAGAAGGTACTCGAGTACCTTCTCCATTCCCTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183163.1-347s1c1
Sequence:CCGGCATCAGTCTGGCTGAGGTAAACTCGAGTTTACCTCAGCCAGACTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183163
RHBDL2 MISSION shRNA Lentiviral Transduction Particles
rhomboid, veinlet-like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183163.1-284s1c1
Sequence:CCGGGCCAGTCCGAAGAACATACTTCTCGAGAAGTATGTTCTTCGGACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183163.1-285s1c1
Sequence:CCGGCCAGTCCGAAGAACATACTTACTCGAGTAAGTATGTTCTTCGGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183163.1-1249s1c1
Sequence:CCGGCCCAGCAGAATTGAATCAATACTCGAGTATTGATTCAATTCTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183163.1-205s1c1
Sequence:CCGGTGAAAGGGAATGGAGAAGGTACTCGAGTACCTTCTCCATTCCCTTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183163.1-347s1c1
Sequence:CCGGCATCAGTCTGGCTGAGGTAAACTCGAGTTTACCTCAGCCAGACTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017821
RHBDL2 MISSION shRNA Bacterial Glycerol Stock
rhomboid, veinlet-like 2 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017821.2-817s1c1
Sequence:CCGGGCTCTCTATAGAAGGTTCTTTCTCGAGAAAGAACCTTCTATAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017821.2-571s1c1
Sequence:CCGGCCCTTGGAAATGGTCCACAAACTCGAGTTTGTGGACCATTTCCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017821.2-871s1c1
Sequence:CCGGGCTCACATTGCAGGTGGATTTCTCGAGAAATCCACCTGCAATGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017821.2-373s1c1
Sequence:CCGGCTGGCAGTGTTTATTTACTATCTCGAGATAGTAAATAAACACTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017821.2-976s1c1
Sequence:CCGGGCATATTTAGCTTGTGTCTTACTCGAGTAAGACACAAGCTAAATATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017821.3-1281s21c1
Sequence:CCGGAGTTGCAAAGATTGCCTATAACTCGAGTTATAGGCAATCTTTGCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017821.3-801s21c1
Sequence:CCGGTGCTCTGATGGGAGGCTATTTCTCGAGAAATAGCCTCCCATCAGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017821.3-880s21c1
Sequence:CCGGCTGATCATCATCCTGATAATTCTCGAGAATTATCAGGATGATGATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017821
RHBDL2 MISSION shRNA shRNA Plasmid DNA
rhomboid, veinlet-like 2 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017821.2-817s1c1
Sequence:CCGGGCTCTCTATAGAAGGTTCTTTCTCGAGAAAGAACCTTCTATAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017821.2-571s1c1
Sequence:CCGGCCCTTGGAAATGGTCCACAAACTCGAGTTTGTGGACCATTTCCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017821.2-871s1c1
Sequence:CCGGGCTCACATTGCAGGTGGATTTCTCGAGAAATCCACCTGCAATGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017821.2-373s1c1
Sequence:CCGGCTGGCAGTGTTTATTTACTATCTCGAGATAGTAAATAAACACTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017821.2-976s1c1
Sequence:CCGGGCATATTTAGCTTGTGTCTTACTCGAGTAAGACACAAGCTAAATATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017821.3-1281s21c1
Sequence:CCGGAGTTGCAAAGATTGCCTATAACTCGAGTTATAGGCAATCTTTGCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017821.3-801s21c1
Sequence:CCGGTGCTCTGATGGGAGGCTATTTCTCGAGAAATAGCCTCCCATCAGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017821.3-880s21c1
Sequence:CCGGCTGATCATCATCCTGATAATTCTCGAGAATTATCAGGATGATGATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017821
RHBDL2 MISSION shRNA Lentiviral Transduction Particles
rhomboid, veinlet-like 2 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017821.2-817s1c1
Sequence:CCGGGCTCTCTATAGAAGGTTCTTTCTCGAGAAAGAACCTTCTATAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017821.2-571s1c1
Sequence:CCGGCCCTTGGAAATGGTCCACAAACTCGAGTTTGTGGACCATTTCCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017821.2-871s1c1
Sequence:CCGGGCTCACATTGCAGGTGGATTTCTCGAGAAATCCACCTGCAATGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017821.2-373s1c1
Sequence:CCGGCTGGCAGTGTTTATTTACTATCTCGAGATAGTAAATAAACACTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017821.2-976s1c1
Sequence:CCGGGCATATTTAGCTTGTGTCTTACTCGAGTAAGACACAAGCTAAATATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017821.3-1281s21c1
Sequence:CCGGAGTTGCAAAGATTGCCTATAACTCGAGTTATAGGCAATCTTTGCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017821.3-801s21c1
Sequence:CCGGTGCTCTGATGGGAGGCTATTTCTCGAGAAATAGCCTCCCATCAGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017821.3-880s21c1
Sequence:CCGGCTGATCATCATCCTGATAATTCTCGAGAATTATCAGGATGATGATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)