EMAIL THIS PAGE TO A FRIEND

RHBDL3

rhomboid, veinlet-like 3 (Drosophila)

82 Gene Product Result for
Synonyms: RHBDL4 VRHO
UniProtKB ID: P58872, A6NMH1, Q495Y6
Gene ID:
Mouse(246104) rhomboid, veinlet-like 3 (Drosophila)
Rat(287556) rhomboid, veinlet-like 3 (Drosophila)
domestic guinea pig(100718588) rhomboid, veinlet-like 3 (Drosophila)
naked mole-rat(101721490) rhomboid, veinlet-like 3 (Drosophila)
cow(535623) rhomboid, veinlet-like 3 (Drosophila)
sheep(101115635) rhomboid, veinlet-like 3 (Drosophila)
Zebrafish(550128) rhomboid, veinlet-like 3 (Drosophila)
chicken(417411) rhomboid, veinlet-like 3 (Drosophila)
domestic cat(101094637) rhomboid, veinlet-like 3 (Drosophila)
Horse(100071775) rhomboid, veinlet-like 3 (Drosophila)
dog(491155) rhomboid, veinlet-like 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138328 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138328 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138328 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139228 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139228 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139228 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138328 Rosetta Predictions human pricing
NM_001105819 Rosetta Predictions rat pricing
NM_139228 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363415 predicted 632
2 SASI_Hs01_00205765 predicted 942
3 SASI_Hs01_00205767 predicted 554
4 SASI_Hs01_00205768 predicted 562
5 SASI_Hs01_00205770 predicted 899
6 SASI_Hs01_00205771 predicted 1711
7 SASI_Hs01_00205772 predicted 889
8 SASI_Hs02_00363416 predicted 1361
9 SASI_Hs02_00363417 predicted 561
10 SASI_Hs01_00205774 predicted 1024
11 SASI_Hs01_00205766 predicted 671
12 SASI_Hs01_00205769 predicted 1360
13 SASI_Hs01_00205773 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105819 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212846 predicted 1796
2 SASI_Rn02_00212847 predicted 445
3 SASI_Rn02_00212848 predicted 1255
4 SASI_Rn02_00212849 predicted 400
5 SASI_Rn02_00212850 predicted 1136
6 SASI_Rn02_00212851 predicted 1502
7 SASI_Rn02_00212852 predicted 689
8 SASI_Rn02_00212853 predicted 1897
9 SASI_Rn02_00212854 predicted 1123
10 SASI_Rn02_00212855 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066874 predicted 1197
2 SASI_Mm01_00066875 predicted 280
3 SASI_Mm01_00066876 predicted 759
4 SASI_Mm01_00066877 predicted 1483
5 SASI_Mm01_00066878 predicted 972
6 SASI_Mm01_00066879 predicted 714
7 SASI_Mm01_00066880 predicted 234
8 SASI_Mm01_00066881 predicted 955
9 SASI_Mm01_00066882 predicted 1097
10 SASI_Mm01_00066883 predicted 1042
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138328
RHBDL3 MISSION shRNA Bacterial Glycerol Stock
rhomboid, veinlet-like 3 (Drosophila)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138328.2-939s21c1
Sequence:CCGGGCTGTGGCCCTTATCTGTATGCTCGAGCATACAGATAAGGGCCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138328.1-602s1c1
Sequence:CCGGCTTGAAGAACTCCCTGGTTTACTCGAGTAAACCAGGGAGTTCTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138328.1-656s1c1
Sequence:CCGGCCTGACATACATCTTCATGCACTCGAGTGCATGAAGATGTATGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138328.1-126s1c1
Sequence:CCGGCACTGGAAAGTCCTGTTTGATCTCGAGATCAAACAGGACTTTCCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138328.1-905s1c1
Sequence:CCGGAGGCATGAAGTGCCAGTTCAACTCGAGTTGAACTGGCACTTCATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138328.1-157s1c1
Sequence:CCGGCTGGGAACACAGGCTACATTACTCGAGTAATGTAGCCTGTGTTCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138328
RHBDL3 MISSION shRNA shRNA Plasmid DNA
rhomboid, veinlet-like 3 (Drosophila)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138328.2-939s21c1
Sequence:CCGGGCTGTGGCCCTTATCTGTATGCTCGAGCATACAGATAAGGGCCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138328.1-602s1c1
Sequence:CCGGCTTGAAGAACTCCCTGGTTTACTCGAGTAAACCAGGGAGTTCTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138328.1-656s1c1
Sequence:CCGGCCTGACATACATCTTCATGCACTCGAGTGCATGAAGATGTATGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138328.1-126s1c1
Sequence:CCGGCACTGGAAAGTCCTGTTTGATCTCGAGATCAAACAGGACTTTCCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138328.1-905s1c1
Sequence:CCGGAGGCATGAAGTGCCAGTTCAACTCGAGTTGAACTGGCACTTCATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138328.1-157s1c1
Sequence:CCGGCTGGGAACACAGGCTACATTACTCGAGTAATGTAGCCTGTGTTCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138328
RHBDL3 MISSION shRNA Lentiviral Transduction Particles
rhomboid, veinlet-like 3 (Drosophila)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138328.2-939s21c1
Sequence:CCGGGCTGTGGCCCTTATCTGTATGCTCGAGCATACAGATAAGGGCCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138328.1-602s1c1
Sequence:CCGGCTTGAAGAACTCCCTGGTTTACTCGAGTAAACCAGGGAGTTCTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138328.1-656s1c1
Sequence:CCGGCCTGACATACATCTTCATGCACTCGAGTGCATGAAGATGTATGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138328.1-126s1c1
Sequence:CCGGCACTGGAAAGTCCTGTTTGATCTCGAGATCAAACAGGACTTTCCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138328.1-905s1c1
Sequence:CCGGAGGCATGAAGTGCCAGTTCAACTCGAGTTGAACTGGCACTTCATGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138328.1-157s1c1
Sequence:CCGGCTGGGAACACAGGCTACATTACTCGAGTAATGTAGCCTGTGTTCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139228
RHBDL3 MISSION shRNA Bacterial Glycerol Stock
rhomboid, veinlet-like 3 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139228.2-721s1c1
Sequence:CCGGGCGCTATGTGACGTACATCTTCTCGAGAAGATGTACGTCACATAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139228.2-949s1c1
Sequence:CCGGCCTAGCCAACATTGTCATGAACTCGAGTTCATGACAATGTTGGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139228.2-571s1c1
Sequence:CCGGGCCCTGGTTCATGATCACAATCTCGAGATTGTGATCATGAACCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139228.2-238s1c1
Sequence:CCGGCGGCTACATCAGCACAGGAAACTCGAGTTTCCTGTGCTGATGTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139228.2-1021s1c1
Sequence:CCGGGATCTGTATGAGTATGGAGTTCTCGAGAACTCCATACTCATACAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139228
RHBDL3 MISSION shRNA shRNA Plasmid DNA
rhomboid, veinlet-like 3 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139228.2-721s1c1
Sequence:CCGGGCGCTATGTGACGTACATCTTCTCGAGAAGATGTACGTCACATAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139228.2-949s1c1
Sequence:CCGGCCTAGCCAACATTGTCATGAACTCGAGTTCATGACAATGTTGGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139228.2-571s1c1
Sequence:CCGGGCCCTGGTTCATGATCACAATCTCGAGATTGTGATCATGAACCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139228.2-238s1c1
Sequence:CCGGCGGCTACATCAGCACAGGAAACTCGAGTTTCCTGTGCTGATGTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139228.2-1021s1c1
Sequence:CCGGGATCTGTATGAGTATGGAGTTCTCGAGAACTCCATACTCATACAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139228
RHBDL3 MISSION shRNA Lentiviral Transduction Particles
rhomboid, veinlet-like 3 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139228.2-721s1c1
Sequence:CCGGGCGCTATGTGACGTACATCTTCTCGAGAAGATGTACGTCACATAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139228.2-949s1c1
Sequence:CCGGCCTAGCCAACATTGTCATGAACTCGAGTTCATGACAATGTTGGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139228.2-571s1c1
Sequence:CCGGGCCCTGGTTCATGATCACAATCTCGAGATTGTGATCATGAACCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139228.2-238s1c1
Sequence:CCGGCGGCTACATCAGCACAGGAAACTCGAGTTTCCTGTGCTGATGTAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139228.2-1021s1c1
Sequence:CCGGGATCTGTATGAGTATGGAGTTCTCGAGAACTCCATACTCATACAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)