EMAIL THIS PAGE TO A FRIEND

RHBG

Rh family, B glycoprotein (gene/pseudogene)

57 Gene Product Result for
Synonyms: SLC42A2
Gene ID:
Human(57127) Summary: This gene encodes one of two non-erythroid members of the Rhesus (Rh) protein family. Non-erythroid Rh protein family members are mainly expressed in the kidney and belong to the methylammonium-ammonium permease/ammonia transporters superfamily. All Rh family proteins are predicted to be transmembrane proteins with 12 membrane spanning domains and intracytoplasmic N- and C-termini. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Mouse(58176) Rhesus blood group-associated B glycoprotein
Rat(310625) Rh family, B glycoprotein
Zebrafish(337596) Rhesus blood group, B glycoprotein
chicken(378792) Rh family, B glycoprotein
domestic cat(101084679) Rh family, B glycoprotein
dog(403538) Rh family, B glycoprotein
cow(282709) Rh family, B glycoprotein
sheep(101104444) Rh family, B glycoprotein
naked mole-rat(101712167) Rh family, B glycoprotein
Domestic Rabbit(100008876) Rh family, B glycoprotein
domestic guinea pig(100723670) Rh family, B glycoprotein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021375 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021375 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021375 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020407 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020407 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020407 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020407 Rosetta Predictions human pricing
NM_183054 Rosetta Predictions rat pricing
NM_021375 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182648 predicted 705
2 SASI_Hs01_00182649 predicted 520
3 SASI_Hs01_00182654 predicted 1040
4 SASI_Hs01_00182655 predicted 341
5 SASI_Hs02_00353401 predicted 698
6 SASI_Hs02_00353402 predicted 408
7 SASI_Hs02_00353403 predicted 573
8 SASI_Hs02_00353404 predicted 679
9 SASI_Hs02_00353405 predicted 525
10 SASI_Hs02_00353406 predicted 693
11 SASI_Hs01_00182650 predicted 875
12 SASI_Hs01_00182651 predicted 1220
13 SASI_Hs01_00182652 predicted 1228
14 SASI_Hs01_00182653 predicted 1498
15 SASI_Hs01_00182656 predicted 299
16 SASI_Hs01_00182657 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183054 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104015 predicted 1430
2 SASI_Rn01_00104016 predicted 977
3 SASI_Rn01_00104017 predicted 1001
4 SASI_Rn02_00269873 predicted 655
5 SASI_Rn01_00104018 predicted 503
6 SASI_Rn01_00104019 predicted 676
7 SASI_Rn01_00104020 predicted 802
8 SASI_Rn01_00104021 predicted 1205
9 SASI_Rn01_00104022 predicted 1388
10 SASI_Rn01_00104023 predicted 658
11 SASI_Rn01_00104024 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152669 predicted 983
2 SASI_Mm01_00152670 predicted 1210
3 SASI_Mm01_00152671 predicted 663
4 SASI_Mm01_00152672 predicted 683
5 SASI_Mm01_00152674 predicted 810
6 SASI_Mm01_00152675 predicted 1393
7 SASI_Mm01_00152676 predicted 610
8 SASI_Mm01_00152677 predicted 518
9 SASI_Mm02_00325967 predicted 1195
10 SASI_Mm01_00152678 predicted 828
11 SASI_Mm01_00152673 predicted 1682
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021375
RHBG MISSION shRNA Bacterial Glycerol Stock
Rh family, B glycoprotein (gene/pseudogene)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021375.2-1007s1c1
Sequence:CCGGCGCCTATCCTTGAATCCAGATCTCGAGATCTGGATTCAAGGATAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021375.2-117s1c1
Sequence:CCGGCTTTGCTATCTTTGTCCGGTACTCGAGTACCGGACAAAGATAGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021375.2-1628s1c1
Sequence:CCGGGCTGGGTGATAAACAATGTATCTCGAGATACATTGTTTATCACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021375.2-573s1c1
Sequence:CCGGGTCCATGACAATTCACACATTCTCGAGAATGTGTGAATTGTCATGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021375.2-1010s1c1
Sequence:CCGGCTATCCTTGAATCCAGATTTACTCGAGTAAATCTGGATTCAAGGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021375
RHBG MISSION shRNA shRNA Plasmid DNA
Rh family, B glycoprotein (gene/pseudogene)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021375.2-1007s1c1
Sequence:CCGGCGCCTATCCTTGAATCCAGATCTCGAGATCTGGATTCAAGGATAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021375.2-117s1c1
Sequence:CCGGCTTTGCTATCTTTGTCCGGTACTCGAGTACCGGACAAAGATAGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021375.2-1628s1c1
Sequence:CCGGGCTGGGTGATAAACAATGTATCTCGAGATACATTGTTTATCACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021375.2-573s1c1
Sequence:CCGGGTCCATGACAATTCACACATTCTCGAGAATGTGTGAATTGTCATGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021375.2-1010s1c1
Sequence:CCGGCTATCCTTGAATCCAGATTTACTCGAGTAAATCTGGATTCAAGGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021375
RHBG MISSION shRNA Lentiviral Transduction Particles
Rh family, B glycoprotein (gene/pseudogene)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021375.2-1007s1c1
Sequence:CCGGCGCCTATCCTTGAATCCAGATCTCGAGATCTGGATTCAAGGATAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021375.2-117s1c1
Sequence:CCGGCTTTGCTATCTTTGTCCGGTACTCGAGTACCGGACAAAGATAGCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021375.2-1628s1c1
Sequence:CCGGGCTGGGTGATAAACAATGTATCTCGAGATACATTGTTTATCACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021375.2-573s1c1
Sequence:CCGGGTCCATGACAATTCACACATTCTCGAGAATGTGTGAATTGTCATGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021375.2-1010s1c1
Sequence:CCGGCTATCCTTGAATCCAGATTTACTCGAGTAAATCTGGATTCAAGGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020407
RHBG MISSION shRNA Bacterial Glycerol Stock
Rh family, B glycoprotein (gene/pseudogene)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020407.1-1226s1c1
Sequence:CCGGGCTGTTTGTCACACTGATGTTCTCGAGAACATCAGTGTGACAAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020407.1-680s1c1
Sequence:CCGGCGTCTACCATTCAGACCTCTTCTCGAGAAGAGGTCTGAATGGTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020407.1-1350s1c1
Sequence:CCGGCCTGGCGAGCATGAGGATAAACTCGAGTTTATCCTCATGCTCGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020407.1-410s1c1
Sequence:CCGGGAGCATGATCAATGCTGACTTCTCGAGAAGTCAGCATTGATCATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020407.1-1001s1c1
Sequence:CCGGGTACAAGTTCTTCACGCCCATCTCGAGATGGGCGTGAAGAACTTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020407
RHBG MISSION shRNA shRNA Plasmid DNA
Rh family, B glycoprotein (gene/pseudogene)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020407.1-1226s1c1
Sequence:CCGGGCTGTTTGTCACACTGATGTTCTCGAGAACATCAGTGTGACAAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020407.1-680s1c1
Sequence:CCGGCGTCTACCATTCAGACCTCTTCTCGAGAAGAGGTCTGAATGGTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020407.1-1350s1c1
Sequence:CCGGCCTGGCGAGCATGAGGATAAACTCGAGTTTATCCTCATGCTCGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020407.1-410s1c1
Sequence:CCGGGAGCATGATCAATGCTGACTTCTCGAGAAGTCAGCATTGATCATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020407.1-1001s1c1
Sequence:CCGGGTACAAGTTCTTCACGCCCATCTCGAGATGGGCGTGAAGAACTTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020407
RHBG MISSION shRNA Lentiviral Transduction Particles
Rh family, B glycoprotein (gene/pseudogene)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020407.1-1226s1c1
Sequence:CCGGGCTGTTTGTCACACTGATGTTCTCGAGAACATCAGTGTGACAAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020407.1-680s1c1
Sequence:CCGGCGTCTACCATTCAGACCTCTTCTCGAGAAGAGGTCTGAATGGTAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020407.1-1350s1c1
Sequence:CCGGCCTGGCGAGCATGAGGATAAACTCGAGTTTATCCTCATGCTCGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020407.1-410s1c1
Sequence:CCGGGAGCATGATCAATGCTGACTTCTCGAGAAGTCAGCATTGATCATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020407.1-1001s1c1
Sequence:CCGGGTACAAGTTCTTCACGCCCATCTCGAGATGGGCGTGAAGAACTTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)