EMAIL THIS PAGE TO A FRIEND

RHCE

Rh blood group, CcEe antigens

47 Gene Product Result for
Synonyms: CD240CE RH RH30A RHC RHE RHIXB RHPI Rh4 RhIVb(J) RhVI RhVIII
Species: Human RHCE(6006), chicken RHCE(419591), dog RHCE(612220), domestic guinea pig Rhce(100718214)
Gene ID:
Human(6006) Summary: The Rh blood group system is the second most clinically significant of the blood groups, second only to ABO. It is also the most polymorphic of the blood groups, with variations due to deletions, gene conversions, and missense mutations. The Rh blood group includes this gene which encodes both the RhC and RhE antigens on a single polypeptide and a second gene which encodes the RhD protein. The classification of Rh-positive and Rh-negative individuals is determined by the presence or absence of the highly immunogenic RhD protein on the surface of erythrocytes. A mutation in this gene results in amorph-type Rh-null disease. Alternative splicing of this gene results in four transcript variants encoding four different isoforms. [provided by RefSeq, Jul 2008]
chicken(419591) Rh blood group, CcEe antigens
dog(612220) Rh blood group, CcEe antigens
domestic guinea pig(100718214) Rh blood group, CcEe antigens
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102000 Anti-RHCE antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020485 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020485 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020485 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020485 Rosetta Predictions human pricing
NM_138616 Rosetta Predictions human pricing
NM_138617 Rosetta Predictions human pricing
NM_138618 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107330 predicted 280
2 SASI_Hs01_00107332 predicted 269
3 SASI_Hs01_00107331 predicted 277
4 SASI_Hs01_00107334 predicted 1432
5 SASI_Hs01_00107335 predicted 1132
6 SASI_Hs01_00107336 predicted 1429
7 SASI_Hs01_00107337 predicted 1422
8 SASI_Hs01_00107338 predicted 664
9 SASI_Hs01_00107339 predicted 1053
10 SASI_Hs02_00353566 predicted 577
11 SASI_Hs01_00107333 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116400 predicted 213
2 SASI_Hs01_00116401 predicted 310
3 SASI_Hs01_00116402 predicted 297
4 SASI_Hs02_00363749 predicted 337
5 SASI_Hs01_00116404 predicted 228
6 SASI_Hs01_00116405 predicted 230
7 SASI_Hs01_00116406 predicted 309
8 SASI_Hs01_00116407 predicted 326
9 SASI_Hs01_00116408 predicted 209
10 SASI_Hs01_00116409 predicted 219
11 SASI_Hs01_00116403 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041677 predicted 209
2 SASI_Hs01_00041678 predicted 309
3 SASI_Hs01_00041679 predicted 298
4 SASI_Hs02_00363750 predicted 339
5 SASI_Hs01_00041681 predicted 236
6 SASI_Hs01_00041682 predicted 226
7 SASI_Hs01_00041683 predicted 304
8 SASI_Hs01_00041684 predicted 322
9 SASI_Hs01_00041685 predicted 207
10 SASI_Hs01_00041686 predicted 222
11 SASI_Hs01_00041680 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211572 predicted 274
2 SASI_Hs01_00211574 predicted 267
3 SASI_Hs01_00211573 predicted 273
4 SASI_Hs01_00211576 predicted 673
5 SASI_Hs01_00211577 predicted 572
6 SASI_Hs01_00211575 predicted 277
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020485
RHCE MISSION shRNA Bacterial Glycerol Stock
Rh blood group, CcEe antigens
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020485.3-1135s21c1
Sequence:CCGGATACTGTCTGGAACGGCAATGCTCGAGCATTGCCGTTCCAGACAGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020485.3-1552s21c1
Sequence:CCGGCATTAGGATGATGCTATCAATCTCGAGATTGATAGCATCATCCTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020485.2-795s1c1
Sequence:CCGGGCCATGTTCAACACCTACTATCTCGAGATAGTAGGTGTTGAACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020485.2-153s1c1
Sequence:CCGGGCTCTCATTCTCCTCTTCTATCTCGAGATAGAAGAGGAGAATGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020485.2-1097s1c1
Sequence:CCGGGCTTGGAGAGATCACCTACATCTCGAGATGTAGGTGATCTCTCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020485.2-1232s1c1
Sequence:CCGGCCTGACAGGTTTGCTCCTAAACTCGAGTTTAGGAGCAAACCTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020485.2-1269s1c1
Sequence:CCGGGCACCTCATGTGGCTAAATATCTCGAGATATTTAGCCACATGAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020485
RHCE MISSION shRNA shRNA Plasmid DNA
Rh blood group, CcEe antigens
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020485.3-1135s21c1
Sequence:CCGGATACTGTCTGGAACGGCAATGCTCGAGCATTGCCGTTCCAGACAGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020485.3-1552s21c1
Sequence:CCGGCATTAGGATGATGCTATCAATCTCGAGATTGATAGCATCATCCTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020485.2-795s1c1
Sequence:CCGGGCCATGTTCAACACCTACTATCTCGAGATAGTAGGTGTTGAACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020485.2-153s1c1
Sequence:CCGGGCTCTCATTCTCCTCTTCTATCTCGAGATAGAAGAGGAGAATGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020485.2-1097s1c1
Sequence:CCGGGCTTGGAGAGATCACCTACATCTCGAGATGTAGGTGATCTCTCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020485.2-1232s1c1
Sequence:CCGGCCTGACAGGTTTGCTCCTAAACTCGAGTTTAGGAGCAAACCTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020485.2-1269s1c1
Sequence:CCGGGCACCTCATGTGGCTAAATATCTCGAGATATTTAGCCACATGAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020485
RHCE MISSION shRNA Lentiviral Transduction Particles
Rh blood group, CcEe antigens
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020485.3-1135s21c1
Sequence:CCGGATACTGTCTGGAACGGCAATGCTCGAGCATTGCCGTTCCAGACAGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020485.3-1552s21c1
Sequence:CCGGCATTAGGATGATGCTATCAATCTCGAGATTGATAGCATCATCCTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020485.2-795s1c1
Sequence:CCGGGCCATGTTCAACACCTACTATCTCGAGATAGTAGGTGTTGAACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020485.2-153s1c1
Sequence:CCGGGCTCTCATTCTCCTCTTCTATCTCGAGATAGAAGAGGAGAATGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020485.2-1097s1c1
Sequence:CCGGGCTTGGAGAGATCACCTACATCTCGAGATGTAGGTGATCTCTCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020485.2-1232s1c1
Sequence:CCGGCCTGACAGGTTTGCTCCTAAACTCGAGTTTAGGAGCAAACCTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020485.2-1269s1c1
Sequence:CCGGGCACCTCATGTGGCTAAATATCTCGAGATATTTAGCCACATGAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)