EMAIL THIS PAGE TO A FRIEND

RHCG

Rh family, C glycoprotein

53 Gene Product Result for
Synonyms: C15orf6 PDRC2 RHGK SLC42A3
UniProtKB ID: Q9UBD6, A8K4D4, Q6X3Y4
Gene ID:
Mouse(56315) Rhesus blood group-associated C glycoprotein
Rat(293048) Rh family, C glycoprotein
domestic guinea pig(100730843) Rh family, C glycoprotein
Domestic Rabbit(100009494) Rh family, C glycoprotein
naked mole-rat(101702086) Rh family, C glycoprotein
cow(281456) Rh family, C glycoprotein
sheep(100528009) Rh family, C glycoprotein
chicken(415490) Rh family, C glycoprotein
dog(479040) Rh family, C glycoprotein
domestic cat(101083517) Rh family, C glycoprotein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016321 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016321 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016321 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019799 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019799 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019799 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029921 MISSION® esiRNA esiRNA human RHCG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016321 Rosetta Predictions human pricing
NM_183053 Rosetta Predictions rat pricing
NM_019799 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214298 predicted 580
2 SASI_Hs01_00214300 predicted 1521
3 SASI_Hs01_00214301 predicted 1075
4 SASI_Hs01_00214302 predicted 363
5 SASI_Hs01_00214303 predicted 615
6 SASI_Hs02_00349258 predicted 659
7 SASI_Hs01_00214306 predicted 1234
8 SASI_Hs01_00214307 predicted 644
9 SASI_Hs02_00349259 predicted 339
10 SASI_Hs02_00349260 predicted 597
11 SASI_Hs01_00214299 predicted 510
12 SASI_Hs01_00214304 predicted 564
13 SASI_Hs01_00214305 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072316 predicted 613
2 SASI_Rn01_00072317 predicted 1578
3 SASI_Rn01_00072318 predicted 496
4 SASI_Rn01_00072319 predicted 687
5 SASI_Rn01_00072320 predicted 1434
6 SASI_Rn01_00072321 predicted 445
7 SASI_Rn01_00072322 predicted 1274
8 SASI_Rn01_00072323 predicted 478
9 SASI_Rn01_00072324 predicted 595
10 SASI_Rn01_00072325 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075191 predicted 1071
2 SASI_Mm01_00075193 predicted 1262
3 SASI_Mm01_00075194 predicted 915
4 SASI_Mm02_00325040 predicted 1515
5 SASI_Mm01_00075196 predicted 1342
6 SASI_Mm02_00325041 predicted 954
7 SASI_Mm01_00075198 predicted 1213
8 SASI_Mm01_00075199 predicted 780
9 SASI_Mm01_00075200 predicted 663
10 SASI_Mm02_00325042 predicted 629
11 SASI_Mm01_00075192 predicted 1014
12 SASI_Mm01_00075195 predicted 1134
13 SASI_Mm01_00075197 predicted 807
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016321
RHCG MISSION shRNA Bacterial Glycerol Stock
Rh family, C glycoprotein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016321.1-807s21c1
Sequence:CCGGGCTTACCTCGGTGGCAATATCCTCGAGGATATTGCCACCGAGGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016321.1-1055s21c1
Sequence:CCGGATGGCATTCCTGGCATCATAGCTCGAGCTATGATGCCAGGAATGCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016321.1-1109s1c1
Sequence:CCGGCCAGCCTTGAAGTCTATGGAACTCGAGTTCCATAGACTTCAAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016321.1-159s1c1
Sequence:CCGGGCACAAGAACTTGAGCGACATCTCGAGATGTCGCTCAAGTTCTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016321.1-354s1c1
Sequence:CCGGCCACTTCTTACAAGACCGCTACTCGAGTAGCGGTCTTGTAAGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016321.1-1137s1c1
Sequence:CCGGGCTTGTCCATTCCTTTGACTTCTCGAGAAGTCAAAGGAATGGACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016321.1-1294s1c1
Sequence:CCGGCCTTCAGATGAGAACTGCTTTCTCGAGAAAGCAGTTCTCATCTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016321
RHCG MISSION shRNA shRNA Plasmid DNA
Rh family, C glycoprotein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016321.1-807s21c1
Sequence:CCGGGCTTACCTCGGTGGCAATATCCTCGAGGATATTGCCACCGAGGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016321.1-1055s21c1
Sequence:CCGGATGGCATTCCTGGCATCATAGCTCGAGCTATGATGCCAGGAATGCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016321.1-1109s1c1
Sequence:CCGGCCAGCCTTGAAGTCTATGGAACTCGAGTTCCATAGACTTCAAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016321.1-159s1c1
Sequence:CCGGGCACAAGAACTTGAGCGACATCTCGAGATGTCGCTCAAGTTCTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016321.1-354s1c1
Sequence:CCGGCCACTTCTTACAAGACCGCTACTCGAGTAGCGGTCTTGTAAGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016321.1-1137s1c1
Sequence:CCGGGCTTGTCCATTCCTTTGACTTCTCGAGAAGTCAAAGGAATGGACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016321.1-1294s1c1
Sequence:CCGGCCTTCAGATGAGAACTGCTTTCTCGAGAAAGCAGTTCTCATCTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016321
RHCG MISSION shRNA Lentiviral Transduction Particles
Rh family, C glycoprotein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016321.1-807s21c1
Sequence:CCGGGCTTACCTCGGTGGCAATATCCTCGAGGATATTGCCACCGAGGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016321.1-1055s21c1
Sequence:CCGGATGGCATTCCTGGCATCATAGCTCGAGCTATGATGCCAGGAATGCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016321.1-1109s1c1
Sequence:CCGGCCAGCCTTGAAGTCTATGGAACTCGAGTTCCATAGACTTCAAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016321.1-159s1c1
Sequence:CCGGGCACAAGAACTTGAGCGACATCTCGAGATGTCGCTCAAGTTCTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016321.1-354s1c1
Sequence:CCGGCCACTTCTTACAAGACCGCTACTCGAGTAGCGGTCTTGTAAGAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016321.1-1137s1c1
Sequence:CCGGGCTTGTCCATTCCTTTGACTTCTCGAGAAGTCAAAGGAATGGACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016321.1-1294s1c1
Sequence:CCGGCCTTCAGATGAGAACTGCTTTCTCGAGAAAGCAGTTCTCATCTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019799
RHCG MISSION shRNA Bacterial Glycerol Stock
Rh family, C glycoprotein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019799.1-1869s1c1
Sequence:CCGGGCCTGTGAGAAGTAGCATGAACTCGAGTTCATGCTACTTCTCACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019799.1-1516s1c1
Sequence:CCGGCCTTGGTACTTCCAACTACTTCTCGAGAAGTAGTTGGAAGTACCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019799.1-875s1c1
Sequence:CCGGCCTCAATACCTACCTCTCCTTCTCGAGAAGGAGAGGTAGGTATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019799.1-572s1c1
Sequence:CCGGGCAGCTGCTCATTATGACCTTCTCGAGAAGGTCATAATGAGCAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019799.1-1078s1c1
Sequence:CCGGCCCTAGGATTTGCATACCTAACTCGAGTTAGGTATGCAAATCCTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019799
RHCG MISSION shRNA shRNA Plasmid DNA
Rh family, C glycoprotein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019799.1-1869s1c1
Sequence:CCGGGCCTGTGAGAAGTAGCATGAACTCGAGTTCATGCTACTTCTCACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019799.1-1516s1c1
Sequence:CCGGCCTTGGTACTTCCAACTACTTCTCGAGAAGTAGTTGGAAGTACCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019799.1-875s1c1
Sequence:CCGGCCTCAATACCTACCTCTCCTTCTCGAGAAGGAGAGGTAGGTATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019799.1-572s1c1
Sequence:CCGGGCAGCTGCTCATTATGACCTTCTCGAGAAGGTCATAATGAGCAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019799.1-1078s1c1
Sequence:CCGGCCCTAGGATTTGCATACCTAACTCGAGTTAGGTATGCAAATCCTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019799
RHCG MISSION shRNA Lentiviral Transduction Particles
Rh family, C glycoprotein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019799.1-1869s1c1
Sequence:CCGGGCCTGTGAGAAGTAGCATGAACTCGAGTTCATGCTACTTCTCACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019799.1-1516s1c1
Sequence:CCGGCCTTGGTACTTCCAACTACTTCTCGAGAAGTAGTTGGAAGTACCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019799.1-875s1c1
Sequence:CCGGCCTCAATACCTACCTCTCCTTCTCGAGAAGGAGAGGTAGGTATTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019799.1-572s1c1
Sequence:CCGGGCAGCTGCTCATTATGACCTTCTCGAGAAGGTCATAATGAGCAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019799.1-1078s1c1
Sequence:CCGGCCCTAGGATTTGCATACCTAACTCGAGTTAGGTATGCAAATCCTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)