EMAIL THIS PAGE TO A FRIEND

RHEBL1

Ras homolog enriched in brain like 1

87 Gene Product Result for
Synonyms: RHEBL1c
UniProtKB ID: Q8TAI7, Q56VH8
Gene ID:
Mouse(69159) Ras homolog enriched in brain like 1
Rat(359959) Ras homolog enriched in brain like 1
domestic cat(101095505) Ras homolog enriched in brain like 1
dog(608884) Ras homolog enriched in brain like 1
cow(353300) Ras homolog enriched in brain like 1
sheep(101120485) Ras homolog enriched in brain like 1
naked mole-rat(101718077) Ras homolog enriched in brain like 1
domestic guinea pig(100727801) Ras homolog enriched in brain like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144593 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144593 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144593 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026967 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026967 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026967 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144593 Rosetta Predictions human pricing
NM_182825 Rosetta Predictions rat pricing
NM_026967 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121356 predicted 666
2 SASI_Hs02_00364385 predicted 392
3 SASI_Hs01_00121357 predicted 833
4 SASI_Hs01_00121358 predicted 585
5 SASI_Hs01_00121359 predicted 649
6 SASI_Hs01_00121360 predicted 256
7 SASI_Hs01_00121362 predicted 410
8 SASI_Hs01_00121363 predicted 284
9 SASI_Hs01_00121364 predicted 559
10 SASI_Hs01_00121365 predicted 446
11 SASI_Hs01_00121361 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182825 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090244 predicted 887
2 SASI_Rn01_00090245 predicted 363
3 SASI_Rn01_00090246 predicted 708
4 SASI_Rn01_00090247 predicted 808
5 SASI_Rn01_00090248 predicted 881
6 SASI_Rn01_00090249 predicted 820
7 SASI_Rn01_00090250 predicted 892
8 SASI_Rn01_00090251 predicted 929
9 SASI_Rn01_00090252 predicted 820
10 SASI_Rn01_00090253 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026967 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112842 predicted 402
2 SASI_Mm02_00331287 predicted 316
3 SASI_Mm01_00112843 predicted 703
4 SASI_Mm01_00112844 predicted 748
5 SASI_Mm01_00112845 predicted 808
6 SASI_Mm02_00331288 predicted 804
7 SASI_Mm01_00112847 predicted 894
8 SASI_Mm01_00112848 predicted 770
9 SASI_Mm01_00112849 predicted 885
10 SASI_Mm01_00112850 predicted 938
11 SASI_Mm01_00112846 predicted 364
12 SASI_Mm01_00112851 predicted 716
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144593
RHEBL1 MISSION shRNA Bacterial Glycerol Stock
Ras homolog enriched in brain like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144593.1-238s21c1
Sequence:CCGGATCCTCGGATACCGCTGTGTACTCGAGTACACAGCGGTATCCGAGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144593.1-668s21c1
Sequence:CCGGAGCTGACTCAAGGCATCTTCACTCGAGTGAAGATGCCTTGAGTCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144593.1-486s1c2
Sequence:CCGGCCAAGTCATTGAGAGTCTGTACTCGAGTACAGACTCTCAATGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144593.1-311s21c1
Sequence:CCGGACGATCCTACAGTGGAGAATACTCGAGTATTCTCCACTGTAGGATCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144593.1-265s21c1
Sequence:CCGGACATCTTTGGCACATCAATTTCTCGAGAAATTGATGTGCCAAAGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144593.1-350s21c1
Sequence:CCGGCTCTTGGCAAAGATGAGTTTCCTCGAGGAAACTCATCTTTGCCAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144593.1-928s1c1
Sequence:CCGGCCTGGATGTCAATGTTTACAACTCGAGTTGTAAACATTGACATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144593.1-403s1c1
Sequence:CCGGGAGTACAGCATTCTGCCCTATCTCGAGATAGGGCAGAATGCTGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144593.1-404s1c1
Sequence:CCGGAGTACAGCATTCTGCCCTATTCTCGAGAATAGGGCAGAATGCTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144593.1-632s1c1
Sequence:CCGGGTGCGACATTTATGGAGTCATCTCGAGATGACTCCATAAATGTCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144593
RHEBL1 MISSION shRNA shRNA Plasmid DNA
Ras homolog enriched in brain like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144593.1-238s21c1
Sequence:CCGGATCCTCGGATACCGCTGTGTACTCGAGTACACAGCGGTATCCGAGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144593.1-668s21c1
Sequence:CCGGAGCTGACTCAAGGCATCTTCACTCGAGTGAAGATGCCTTGAGTCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144593.1-486s1c2
Sequence:CCGGCCAAGTCATTGAGAGTCTGTACTCGAGTACAGACTCTCAATGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144593.1-311s21c1
Sequence:CCGGACGATCCTACAGTGGAGAATACTCGAGTATTCTCCACTGTAGGATCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144593.1-265s21c1
Sequence:CCGGACATCTTTGGCACATCAATTTCTCGAGAAATTGATGTGCCAAAGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144593.1-350s21c1
Sequence:CCGGCTCTTGGCAAAGATGAGTTTCCTCGAGGAAACTCATCTTTGCCAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144593.1-928s1c1
Sequence:CCGGCCTGGATGTCAATGTTTACAACTCGAGTTGTAAACATTGACATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144593.1-403s1c1
Sequence:CCGGGAGTACAGCATTCTGCCCTATCTCGAGATAGGGCAGAATGCTGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144593.1-404s1c1
Sequence:CCGGAGTACAGCATTCTGCCCTATTCTCGAGAATAGGGCAGAATGCTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144593.1-632s1c1
Sequence:CCGGGTGCGACATTTATGGAGTCATCTCGAGATGACTCCATAAATGTCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144593
RHEBL1 MISSION shRNA Lentiviral Transduction Particles
Ras homolog enriched in brain like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144593.1-238s21c1
Sequence:CCGGATCCTCGGATACCGCTGTGTACTCGAGTACACAGCGGTATCCGAGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144593.1-668s21c1
Sequence:CCGGAGCTGACTCAAGGCATCTTCACTCGAGTGAAGATGCCTTGAGTCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144593.1-486s1c2
Sequence:CCGGCCAAGTCATTGAGAGTCTGTACTCGAGTACAGACTCTCAATGACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144593.1-311s21c1
Sequence:CCGGACGATCCTACAGTGGAGAATACTCGAGTATTCTCCACTGTAGGATCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144593.1-265s21c1
Sequence:CCGGACATCTTTGGCACATCAATTTCTCGAGAAATTGATGTGCCAAAGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144593.1-350s21c1
Sequence:CCGGCTCTTGGCAAAGATGAGTTTCCTCGAGGAAACTCATCTTTGCCAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144593.1-928s1c1
Sequence:CCGGCCTGGATGTCAATGTTTACAACTCGAGTTGTAAACATTGACATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144593.1-403s1c1
Sequence:CCGGGAGTACAGCATTCTGCCCTATCTCGAGATAGGGCAGAATGCTGTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144593.1-404s1c1
Sequence:CCGGAGTACAGCATTCTGCCCTATTCTCGAGAATAGGGCAGAATGCTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144593.1-632s1c1
Sequence:CCGGGTGCGACATTTATGGAGTCATCTCGAGATGACTCCATAAATGTCGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026967
VALIDATED
RHEBL1 MISSION shRNA Bacterial Glycerol Stock
Ras homolog enriched in brain like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026967.3-568s21c1
Sequence:CCGGCTACACGAAGGCCACGGTAAACTCGAGTTTACCGTGGCCTTCGTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026967.3-688s1c2
Sequence:CCGGGCGATGTTTATGGAGTCGTCTCTCGAGAGACGACTCCATAAACATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026967.3-1069s21c1
Sequence:CCGGAGTCTGTACAGTAGGGATATGCTCGAGCATATCCCTACTGTACAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026967.3-792s21c1
Sequence:CCGGAGACCGCCGATGCTATCTTATCTCGAGATAAGATAGCATCGGCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026967.3-701s21c1
Sequence:CCGGAGTCGTCTGCTCGGGATAATCCTCGAGGATTATCCCGAGCAGACGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026967.3-531s21c1
Sequence:CCGGGCGCAGCTTTCAGATCGTTAACTCGAGTTAACGATCTGAAAGCTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026967.3-935s1c1
Sequence:CCGGGCACACAGTATGGCACTCTTACTCGAGTAAGAGTGCCATACTGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026967.3-363s1c1
Sequence:CCGGCTACGATCCTACAGTGGAGAACTCGAGTTCTCCACTGTAGGATCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026967.3-712s1c1
Sequence:CCGGCGGGATAATCAGCTAACTCAACTCGAGTTGAGTTAGCTGATTATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026967.3-504s1c1
Sequence:CCGGCGTTCTTGTATACTCGGTTAACTCGAGTTAACCGAGTATACAAGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026967
VALIDATED
RHEBL1 MISSION shRNA shRNA Plasmid DNA
Ras homolog enriched in brain like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026967.3-568s21c1
Sequence:CCGGCTACACGAAGGCCACGGTAAACTCGAGTTTACCGTGGCCTTCGTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026967.3-688s1c2
Sequence:CCGGGCGATGTTTATGGAGTCGTCTCTCGAGAGACGACTCCATAAACATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026967.3-1069s21c1
Sequence:CCGGAGTCTGTACAGTAGGGATATGCTCGAGCATATCCCTACTGTACAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026967.3-792s21c1
Sequence:CCGGAGACCGCCGATGCTATCTTATCTCGAGATAAGATAGCATCGGCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026967.3-701s21c1
Sequence:CCGGAGTCGTCTGCTCGGGATAATCCTCGAGGATTATCCCGAGCAGACGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026967.3-531s21c1
Sequence:CCGGGCGCAGCTTTCAGATCGTTAACTCGAGTTAACGATCTGAAAGCTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026967.3-935s1c1
Sequence:CCGGGCACACAGTATGGCACTCTTACTCGAGTAAGAGTGCCATACTGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026967.3-363s1c1
Sequence:CCGGCTACGATCCTACAGTGGAGAACTCGAGTTCTCCACTGTAGGATCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026967.3-712s1c1
Sequence:CCGGCGGGATAATCAGCTAACTCAACTCGAGTTGAGTTAGCTGATTATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026967.3-504s1c1
Sequence:CCGGCGTTCTTGTATACTCGGTTAACTCGAGTTAACCGAGTATACAAGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026967
VALIDATED
RHEBL1 MISSION shRNA Lentiviral Transduction Particles
Ras homolog enriched in brain like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026967.3-568s21c1
Sequence:CCGGCTACACGAAGGCCACGGTAAACTCGAGTTTACCGTGGCCTTCGTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026967.3-688s1c2
Sequence:CCGGGCGATGTTTATGGAGTCGTCTCTCGAGAGACGACTCCATAAACATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026967.3-1069s21c1
Sequence:CCGGAGTCTGTACAGTAGGGATATGCTCGAGCATATCCCTACTGTACAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026967.3-792s21c1
Sequence:CCGGAGACCGCCGATGCTATCTTATCTCGAGATAAGATAGCATCGGCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026967.3-701s21c1
Sequence:CCGGAGTCGTCTGCTCGGGATAATCCTCGAGGATTATCCCGAGCAGACGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026967.3-531s21c1
Sequence:CCGGGCGCAGCTTTCAGATCGTTAACTCGAGTTAACGATCTGAAAGCTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026967.3-935s1c1
Sequence:CCGGGCACACAGTATGGCACTCTTACTCGAGTAAGAGTGCCATACTGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026967.3-363s1c1
Sequence:CCGGCTACGATCCTACAGTGGAGAACTCGAGTTCTCCACTGTAGGATCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026967.3-712s1c1
Sequence:CCGGCGGGATAATCAGCTAACTCAACTCGAGTTGAGTTAGCTGATTATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026967.3-504s1c1
Sequence:CCGGCGTTCTTGTATACTCGGTTAACTCGAGTTAACCGAGTATACAAGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)