EMAIL THIS PAGE TO A FRIEND

RHO

rhodopsin

80 Gene Product Result for
Synonyms: CSNBAD1 OPN2 RP4
UniProtKB ID: P08100, Q16414, Q2M249
Gene ID:
Human(6010) Summary: Retinitis pigmentosa is an inherited progressive disease which is a major cause of blindness in western communities. It can be inherited as an autosomal dominant, autosomal recessive, or X-linked recessive disorder. In the autosomal dominant form,which comprises about 25% of total cases, approximately 30% of families have mutations in the gene encoding the rod photoreceptor-specific protein rhodopsin. This is the transmembrane protein which, when photoexcited, initiates the visual transduction cascade. Defects in this gene are also one of the causes of congenital stationary night blindness. [provided by RefSeq, Jul 2008]
Mouse(212541) rhodopsin
Rat(24717) rhodopsin
cow(509933) rhodopsin
sheep(101123241) rhodopsin
fruit fly(38168) rhomboid
Zebrafish(30295) rhodopsin
chicken(396486) rhodopsin (opsin 2, rod pigment) (retinitis pigmentosa 4, autosomal dominant)
dog(493763) rhodopsin
chicken(751791) rhodopsin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200762 Anti-Opsin antibody, Mouse monoclonal clone RET-P1, purified from hybridoma cell culture fish, mouse, bovine, rabbit, avian, amphibian, rat, human, turtle
ELISA, immunofluorescence, immunohistochemistry, radioimmunoassay, western blot pricing
HPA013440 Anti-RHO antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunohistochemistry pricing
R9153 Anti-Rhodopsin antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB4502636 Anti-Rhodopsin antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
O4886 Monoclonal Anti-Opsin antibody produced in mouse clone RET-P1, ascites fluid goldfish, bovine, duck, amphibian, rabbit, rat, turtle, tiger salamander, dove, quail, mouse, human
electron microscopy, ELISA, immunocytochemistry, immunohistochemistry, radioimmunoassay, western blot pricing
R5403 Monoclonal Anti-Rhodopsin antibody produced in mouse clone 1D4, purified immunoglobulin, buffered aqueous solution bovine, human, rat
immunocytochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000539 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000539 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000539 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145383 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145383 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145383 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU007161 MISSION® esiRNA esiRNA targeting mouse Rho (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000539 Rosetta Predictions human pricing
NM_033441 Rosetta Predictions rat pricing
NM_145383 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065400 predicted 550
2 SASI_Hs01_00065401 predicted 502
3 SASI_Hs01_00065402 predicted 371
4 SASI_Hs01_00065403 predicted 303
5 SASI_Hs01_00065404 predicted 997
6 SASI_Hs01_00065405 predicted 999
7 SASI_Hs01_00065406 predicted 210
8 SASI_Hs01_00065407 predicted 544
9 SASI_Hs01_00065408 predicted 371
10 SASI_Hs02_00302758 predicted 999
11 SASI_Hs01_00065409 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033441 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092485 predicted 401
2 SASI_Rn01_00092486 predicted 483
3 SASI_Rn01_00092487 predicted 894
4 SASI_Rn01_00092488 predicted 254
5 SASI_Rn01_00092489 predicted 653
6 SASI_Rn01_00092490 predicted 1049
7 SASI_Rn01_00092491 predicted 202
8 SASI_Rn01_00092492 predicted 836
9 SASI_Rn01_00092493 predicted 488
10 SASI_Rn01_00092494 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150673 predicted 721
2 SASI_Mm01_00150674 predicted 985
3 SASI_Mm01_00150675 predicted 527
4 SASI_Mm02_00340703 predicted 625
5 SASI_Mm01_00150676 predicted 401
6 SASI_Mm01_00150677 predicted 819
7 SASI_Mm01_00150678 predicted 1040
8 SASI_Mm01_00150679 predicted 193
9 SASI_Mm01_00150680 predicted 951
10 SASI_Mm01_00150681 predicted 527
11 SASI_Mm01_00150682 predicted 351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000539
RHO MISSION shRNA Bacterial Glycerol Stock
rhodopsin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000539.3-995s21c1
Sequence:CCGGCTACAACCCTGTCATCTATATCTCGAGATATAGATGACAGGGTTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000539.3-958s21c1
Sequence:CCGGTGACCATCCCAGCGTTCTTTGCTCGAGCAAAGAACGCTGGGATGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000539.x-682s1c1
Sequence:CCGGCGGAGGTCAACAACGAGTCTTCTCGAGAAGACTCGTTGTTGACCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000539.x-254s1c1
Sequence:CCGGCATCAACTTCCTCACGCTCTACTCGAGTAGAGCGTGAGGAAGTTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000539.x-389s1c1
Sequence:CCGGTCTGCATGGATACTTCGTCTTCTCGAGAAGACGAAGTATCCATGCAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000539.x-902s1c1
Sequence:CCGGCAGCGTGGCATTCTACATCTTCTCGAGAAGATGTAGAATGCCACGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003752    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000539.x-1841s1c1
Sequence:CCGGACCTCCTGATAGTGAACATTTCTCGAGAAATGTTCACTATCAGGAGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000539.3-1152s21c1
Sequence:CCGGAGGACTCTGTGGCCGACTATACTCGAGTATAGTCGGCCACAGAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000539
RHO MISSION shRNA shRNA Plasmid DNA
rhodopsin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000539.3-995s21c1
Sequence:CCGGCTACAACCCTGTCATCTATATCTCGAGATATAGATGACAGGGTTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000539.3-958s21c1
Sequence:CCGGTGACCATCCCAGCGTTCTTTGCTCGAGCAAAGAACGCTGGGATGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000539.x-682s1c1
Sequence:CCGGCGGAGGTCAACAACGAGTCTTCTCGAGAAGACTCGTTGTTGACCTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000539.x-254s1c1
Sequence:CCGGCATCAACTTCCTCACGCTCTACTCGAGTAGAGCGTGAGGAAGTTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000539.x-389s1c1
Sequence:CCGGTCTGCATGGATACTTCGTCTTCTCGAGAAGACGAAGTATCCATGCAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000539.x-902s1c1
Sequence:CCGGCAGCGTGGCATTCTACATCTTCTCGAGAAGATGTAGAATGCCACGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003752    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000539.x-1841s1c1
Sequence:CCGGACCTCCTGATAGTGAACATTTCTCGAGAAATGTTCACTATCAGGAGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000539.3-1152s21c1
Sequence:CCGGAGGACTCTGTGGCCGACTATACTCGAGTATAGTCGGCCACAGAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000539
RHO MISSION shRNA Lentiviral Transduction Particles
rhodopsin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000539.3-995s21c1
Sequence:CCGGCTACAACCCTGTCATCTATATCTCGAGATATAGATGACAGGGTTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000539.3-958s21c1
Sequence:CCGGTGACCATCCCAGCGTTCTTTGCTCGAGCAAAGAACGCTGGGATGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000539.x-682s1c1
Sequence:CCGGCGGAGGTCAACAACGAGTCTTCTCGAGAAGACTCGTTGTTGACCTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000539.x-254s1c1
Sequence:CCGGCATCAACTTCCTCACGCTCTACTCGAGTAGAGCGTGAGGAAGTTGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000539.x-389s1c1
Sequence:CCGGTCTGCATGGATACTTCGTCTTCTCGAGAAGACGAAGTATCCATGCAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000539.x-902s1c1
Sequence:CCGGCAGCGTGGCATTCTACATCTTCTCGAGAAGATGTAGAATGCCACGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003752    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000539.x-1841s1c1
Sequence:CCGGACCTCCTGATAGTGAACATTTCTCGAGAAATGTTCACTATCAGGAGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000539.3-1152s21c1
Sequence:CCGGAGGACTCTGTGGCCGACTATACTCGAGTATAGTCGGCCACAGAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145383
RHO MISSION shRNA Bacterial Glycerol Stock
rhodopsin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145383.1-624s1c1
Sequence:CCGGCATGCAATGTTCATGCGGGATCTCGAGATCCCGCATGAACATTGCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145383.1-975s1c1
Sequence:CCGGCATCTATAACCCGGTCATCTACTCGAGTAGATGACCGGGTTATAGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145383.1-546s1c1
Sequence:CCGGTGTGGTCTTCACCTGGATCATCTCGAGATGATCCAGGTGAAGACCACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145383.1-678s1c1
Sequence:CCGGCGAATCCTTTGTCATCTACATCTCGAGATGTAGATGACAAAGGATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145383.1-717s1c1
Sequence:CCGGCATTCCTATGATCGTCATCTTCTCGAGAAGATGACGATCATAGGAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145383
RHO MISSION shRNA shRNA Plasmid DNA
rhodopsin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145383.1-624s1c1
Sequence:CCGGCATGCAATGTTCATGCGGGATCTCGAGATCCCGCATGAACATTGCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145383.1-975s1c1
Sequence:CCGGCATCTATAACCCGGTCATCTACTCGAGTAGATGACCGGGTTATAGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145383.1-546s1c1
Sequence:CCGGTGTGGTCTTCACCTGGATCATCTCGAGATGATCCAGGTGAAGACCACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145383.1-678s1c1
Sequence:CCGGCGAATCCTTTGTCATCTACATCTCGAGATGTAGATGACAAAGGATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145383.1-717s1c1
Sequence:CCGGCATTCCTATGATCGTCATCTTCTCGAGAAGATGACGATCATAGGAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145383
RHO MISSION shRNA Lentiviral Transduction Particles
rhodopsin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145383.1-624s1c1
Sequence:CCGGCATGCAATGTTCATGCGGGATCTCGAGATCCCGCATGAACATTGCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145383.1-975s1c1
Sequence:CCGGCATCTATAACCCGGTCATCTACTCGAGTAGATGACCGGGTTATAGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145383.1-546s1c1
Sequence:CCGGTGTGGTCTTCACCTGGATCATCTCGAGATGATCCAGGTGAAGACCACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145383.1-678s1c1
Sequence:CCGGCGAATCCTTTGTCATCTACATCTCGAGATGTAGATGACAAAGGATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145383.1-717s1c1
Sequence:CCGGCATTCCTATGATCGTCATCTTCTCGAGAAGATGACGATCATAGGAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)