EMAIL THIS PAGE TO A FRIEND

RHOA

ras homolog family member A

148 Gene Product Result for
Synonyms: ARH12 ARHA RHO12 RHOH12
UniProtKB ID: P61586, P06749, Q53HM4, Q5U024, Q9UDJ0, Q9UEJ4
Gene ID:
Mouse(11848) ras homolog gene family, member A
Rat(117273) ras homolog family member A
chicken(395442) ras homolog gene family, member A
domestic cat(101084011) ras homolog family member A
dog(403954) ras homolog family member A
cow(338049) ras homolog gene family, member A
sheep(100302078) ras homolog family member A
domestic guinea pig(100733542) ras homolog family member A
Domestic Rabbit(100008954) ras homolog family member A
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503986 Anti-phospho-RhoA (pSer188) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
GW20040F Anti-RhoA antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
R9404 Anti-RhoA antibody produced in rabbit ~2 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, monkey, human
western blot pricing
SAB4501661 Anti-RHOA antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
HPA062346 Anti-RHOA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
WH0000387M3 Monoclonal Anti-RHOA antibody produced in mouse clone 1A11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1400017 Monoclonal Anti-RHOA antibody produced in mouse clone 1B12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1400018 Monoclonal Anti-RHOA antibody produced in mouse clone 1C1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, proximity ligation assay, western blot pricing
SAB1403567 Monoclonal Anti-RHOA antibody produced in mouse clone 1C10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001664 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001664 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001664 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016802 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016802 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016802 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001664 siRNAs that have been validated in the lab human pricing
NM_057132 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001664 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132355 validated 499
2 SASI_Hs02_00332284 predicted 371
3 SASI_Hs02_00332285 predicted 1060
4 SASI_Hs02_00332286 predicted 898
5 SASI_Hs02_00332287 predicted 1000
6 SASI_Hs02_00332288 predicted 983
7 SASI_Hs02_00332289 predicted 1098
8 SASI_Hs02_00332290 predicted 1140
9 SASI_Hs01_00132357 predicted 754
10 SASI_Hs01_00132358 predicted 951
11 SASI_Hs01_00132354 predicted 512
12 SASI_Hs01_00132356 predicted 607
13 SASI_Hs01_00132359 predicted 705
14 SASI_Hs01_00132360 predicted 504
15 SASI_Hs01_00132361 predicted 716
16 SASI_Hs01_00132362 predicted 408
17 SASI_Hs01_00132363 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057132 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267078 predicted 223
2 SASI_Rn02_00267079 predicted 307
3 SASI_Rn02_00267080 predicted 253
4 SASI_Rn02_00267081 predicted 223
5 SASI_Rn02_00267082 predicted 253
6 SASI_Rn02_00267083 predicted 354
7 SASI_Rn02_00267084 predicted 224
8 SASI_Rn02_00267085 predicted 303
9 SASI_Rn02_00267086 predicted 214
10 SASI_Rn02_00267087 predicted 251
11 SASI_Rn01_00121234 predicted 805
12 SASI_Rn01_00121235 predicted 1063
13 SASI_Rn01_00121236 predicted 231
14 SASI_Rn01_00121237 predicted 900
15 SASI_Rn01_00121238 predicted 302
16 SASI_Rn01_00121239 predicted 894
17 SASI_Rn01_00121240 predicted 1041
18 SASI_Rn01_00121241 predicted 859
19 SASI_Rn01_00121242 predicted 607
20 SASI_Rn01_00121243 predicted 783
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001664
VALIDATED
RHOA MISSION shRNA Bacterial Glycerol Stock
ras homolog family member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001664.1-494s1c1
Sequence:CCGGGTTGGGAATAAGAAGGATCTTCTCGAGAAGATCCTTCTTATTCCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001664.1-300s1c1
Sequence:CCGGGAAAGCAGGTAGAGTTGGCTTCTCGAGAAGCCAACTCTACCTGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001664.1-199s1c1
Sequence:CCGGTGGAAAGACATGCTTGCTCATCTCGAGATGAGCAAGCATGTCTTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001664.1-616s1c1
Sequence:CCGGGTACATGGAGTGTTCAGCAAACTCGAGTTTGCTGAACACTCCATGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001664.1-382s1c1
Sequence:CCGGCGATGTTATACTGATGTGTTTCTCGAGAAACACATCAGTATAACATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001664
VALIDATED
RHOA MISSION shRNA shRNA Plasmid DNA
ras homolog family member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001664.1-494s1c1
Sequence:CCGGGTTGGGAATAAGAAGGATCTTCTCGAGAAGATCCTTCTTATTCCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001664.1-300s1c1
Sequence:CCGGGAAAGCAGGTAGAGTTGGCTTCTCGAGAAGCCAACTCTACCTGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001664.1-199s1c1
Sequence:CCGGTGGAAAGACATGCTTGCTCATCTCGAGATGAGCAAGCATGTCTTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001664.1-616s1c1
Sequence:CCGGGTACATGGAGTGTTCAGCAAACTCGAGTTTGCTGAACACTCCATGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001664.1-382s1c1
Sequence:CCGGCGATGTTATACTGATGTGTTTCTCGAGAAACACATCAGTATAACATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001664
VALIDATED
RHOA MISSION shRNA Lentiviral Transduction Particles
ras homolog family member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001664.1-494s1c1
Sequence:CCGGGTTGGGAATAAGAAGGATCTTCTCGAGAAGATCCTTCTTATTCCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001664.1-300s1c1
Sequence:CCGGGAAAGCAGGTAGAGTTGGCTTCTCGAGAAGCCAACTCTACCTGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001664.1-199s1c1
Sequence:CCGGTGGAAAGACATGCTTGCTCATCTCGAGATGAGCAAGCATGTCTTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001664.1-616s1c1
Sequence:CCGGGTACATGGAGTGTTCAGCAAACTCGAGTTTGCTGAACACTCCATGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001664.1-382s1c1
Sequence:CCGGCGATGTTATACTGATGTGTTTCTCGAGAAACACATCAGTATAACATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016802
VALIDATED
RHOA MISSION shRNA Bacterial Glycerol Stock
ras homolog family member A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016802.3-485s1c1
Sequence:CCGGGCTTGCTCATAGTCTTCAGCACTCGAGTGCTGAAGACTATGAGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016802.3-656s1c1
Sequence:CCGGCCGATGTTATATTGATGTGTTCTCGAGAACACATCAATATAACATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016802.3-790s1c1
Sequence:CCGGCGGAATGACGAGCACACGAGACTCGAGTCTCGTGTGCTCGTCATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016802.3-733s1c1
Sequence:CCGGGTCAAGCATTTCTGTCCAAATCTCGAGATTTGGACAGAAATGCTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016802.3-1593s1c1
Sequence:CCGGCCCAGACTAGATGTAGTATTTCTCGAGAAATACTACATCTAGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016802.4-524s21c1
Sequence:CCGGTCTATGTGCCCACGGTGTTTGCTCGAGCAAACACCGTGGGCACATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016802.4-1019s21c1
Sequence:CCGGACGCAGCCTCATGCGGTTAATCTCGAGATTAACCGCATGAGGCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016802.4-682s21c1
Sequence:CCGGATTGACAGCCCTGATAGTTTACTCGAGTAAACTATCAGGGCTGTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016802.4-733s21c1
Sequence:CCGGGTCAAGCATTTCTGTCCAAATCTCGAGATTTGGACAGAAATGCTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016802.4-605s21c1
Sequence:CCGGCAGCTGGACAGGAAGATTATGCTCGAGCATAATCTTCCTGTCCAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016802
VALIDATED
RHOA MISSION shRNA shRNA Plasmid DNA
ras homolog family member A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016802.3-485s1c1
Sequence:CCGGGCTTGCTCATAGTCTTCAGCACTCGAGTGCTGAAGACTATGAGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016802.3-656s1c1
Sequence:CCGGCCGATGTTATATTGATGTGTTCTCGAGAACACATCAATATAACATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016802.3-790s1c1
Sequence:CCGGCGGAATGACGAGCACACGAGACTCGAGTCTCGTGTGCTCGTCATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016802.3-733s1c1
Sequence:CCGGGTCAAGCATTTCTGTCCAAATCTCGAGATTTGGACAGAAATGCTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016802.3-1593s1c1
Sequence:CCGGCCCAGACTAGATGTAGTATTTCTCGAGAAATACTACATCTAGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016802.4-524s21c1
Sequence:CCGGTCTATGTGCCCACGGTGTTTGCTCGAGCAAACACCGTGGGCACATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016802.4-1019s21c1
Sequence:CCGGACGCAGCCTCATGCGGTTAATCTCGAGATTAACCGCATGAGGCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016802.4-682s21c1
Sequence:CCGGATTGACAGCCCTGATAGTTTACTCGAGTAAACTATCAGGGCTGTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016802.4-733s21c1
Sequence:CCGGGTCAAGCATTTCTGTCCAAATCTCGAGATTTGGACAGAAATGCTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016802.4-605s21c1
Sequence:CCGGCAGCTGGACAGGAAGATTATGCTCGAGCATAATCTTCCTGTCCAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016802
VALIDATED
RHOA MISSION shRNA Lentiviral Transduction Particles
ras homolog family member A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016802.3-485s1c1
Sequence:CCGGGCTTGCTCATAGTCTTCAGCACTCGAGTGCTGAAGACTATGAGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016802.3-656s1c1
Sequence:CCGGCCGATGTTATATTGATGTGTTCTCGAGAACACATCAATATAACATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016802.3-790s1c1
Sequence:CCGGCGGAATGACGAGCACACGAGACTCGAGTCTCGTGTGCTCGTCATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016802.3-733s1c1
Sequence:CCGGGTCAAGCATTTCTGTCCAAATCTCGAGATTTGGACAGAAATGCTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016802.3-1593s1c1
Sequence:CCGGCCCAGACTAGATGTAGTATTTCTCGAGAAATACTACATCTAGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016802.4-524s21c1
Sequence:CCGGTCTATGTGCCCACGGTGTTTGCTCGAGCAAACACCGTGGGCACATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016802.4-1019s21c1
Sequence:CCGGACGCAGCCTCATGCGGTTAATCTCGAGATTAACCGCATGAGGCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016802.4-682s21c1
Sequence:CCGGATTGACAGCCCTGATAGTTTACTCGAGTAAACTATCAGGGCTGTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016802.4-733s21c1
Sequence:CCGGGTCAAGCATTTCTGTCCAAATCTCGAGATTTGGACAGAAATGCTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016802.4-605s21c1
Sequence:CCGGCAGCTGGACAGGAAGATTATGCTCGAGCATAATCTTCCTGTCCAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)