EMAIL THIS PAGE TO A FRIEND

RHOB

ras homolog family member B

122 Gene Product Result for
Synonyms: ARH6 ARHB MST081 MSTP081 RHOH6
Gene ID:
Mouse(11852) ras homolog gene family, member B
Rat(64373) ras homolog family member B
cow(515118) ras homolog gene family, member B
sheep(100158235) ras homolog family member B
Goat(100860818) ras homolog family member B
naked mole-rat(101698421) ras homolog family member B
domestic guinea pig(100721258) ras homolog family member B
chicken(395734) ras homolog family member B
dog(403670) ras homolog family member B
domestic cat(101099371) ras homolog family member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007483 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007483 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007483 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004040 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004040 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004040 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120331 MISSION® esiRNA esiRNA human RHOB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004040 Rosetta Predictions human pricing
NM_022542 Rosetta Predictions rat pricing
NM_007483 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130025 predicted 832
2 SASI_Hs01_00130018 predicted 939
3 SASI_Hs01_00130019 predicted 947
4 SASI_Hs01_00130021 predicted 1389
5 SASI_Hs01_00130022 predicted 1324
6 SASI_Hs02_00336788 predicted 770
7 SASI_Hs02_00336789 predicted 804
8 SASI_Hs02_00336790 predicted 1326
9 SASI_Hs01_00130024 predicted 448
10 SASI_Hs01_00130026 predicted 508
11 SASI_Hs01_00130020 predicted 622
12 SASI_Hs01_00130023 predicted 703
13 SASI_Hs01_00130027 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022542 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078579 predicted 830
2 SASI_Rn01_00078580 predicted 1270
3 SASI_Rn02_00263307 predicted 1276
4 SASI_Rn01_00078581 predicted 1160
5 SASI_Rn01_00078582 predicted 612
6 SASI_Rn01_00078583 predicted 1260
7 SASI_Rn01_00078584 predicted 1006
8 SASI_Rn01_00078585 predicted 564
9 SASI_Rn01_00078586 predicted 729
10 SASI_Rn01_00078587 predicted 748
11 SASI_Rn01_00078588 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007483 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182147 predicted 1224
2 SASI_Mm01_00182148 predicted 905
3 SASI_Mm01_00182149 predicted 1336
4 SASI_Mm01_00182150 predicted 1009
5 SASI_Mm01_00182151 predicted 1413
6 SASI_Mm01_00182152 predicted 547
7 SASI_Mm01_00182153 predicted 642
8 SASI_Mm01_00182154 predicted 800
9 SASI_Mm01_00182155 predicted 1077
10 SASI_Mm01_00182156 predicted 770
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007483
VALIDATED
RHOB MISSION shRNA Bacterial Glycerol Stock
ras homolog family member B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007483.2-584s1c1
Sequence:CCGGCGACGTCATCCTTATGTGCTTCTCGAGAAGCACATAAGGATGACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007483.2-1711s1c1
Sequence:CCGGCCTGTCCTACAAATGAACATTCTCGAGAATGTTCATTTGTAGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007483.2-422s1c1
Sequence:CCGGCGTGTTCAGTAAAGACGAATTCTCGAGAATTCGTCTTTACTGAACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007483.2-540s1c1
Sequence:CCGGCAGGAGGACTACGATCGTTTACTCGAGTAAACGATCGTAGTCCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007483.2-459s1c1
Sequence:CCGGCCCACCGTGTTCGAGAACTATCTCGAGATAGTTCTCGAACACGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007483.2-923s21c1
Sequence:CCGGCAACTGCTGCAAGGTGCTATGCTCGAGCATAGCACCTTGCAGCAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007483.2-1711s21c1
Sequence:CCGGCCTGTCCTACAAATGAACATTCTCGAGAATGTTCATTTGTAGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007483.2-584s21c1
Sequence:CCGGCGACGTCATCCTTATGTGCTTCTCGAGAAGCACATAAGGATGACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007483.2-644s21c1
Sequence:CCGGGAAGTGGGTGCCCGAGGTAAACTCGAGTTTACCTCGGGCACCCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007483.2-800s21c1
Sequence:CCGGGCGCATCCAAGCCTATGACTACTCGAGTAGTCATAGGCTTGGATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007483
VALIDATED
RHOB MISSION shRNA shRNA Plasmid DNA
ras homolog family member B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007483.2-584s1c1
Sequence:CCGGCGACGTCATCCTTATGTGCTTCTCGAGAAGCACATAAGGATGACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007483.2-1711s1c1
Sequence:CCGGCCTGTCCTACAAATGAACATTCTCGAGAATGTTCATTTGTAGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007483.2-422s1c1
Sequence:CCGGCGTGTTCAGTAAAGACGAATTCTCGAGAATTCGTCTTTACTGAACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007483.2-540s1c1
Sequence:CCGGCAGGAGGACTACGATCGTTTACTCGAGTAAACGATCGTAGTCCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007483.2-459s1c1
Sequence:CCGGCCCACCGTGTTCGAGAACTATCTCGAGATAGTTCTCGAACACGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007483.2-923s21c1
Sequence:CCGGCAACTGCTGCAAGGTGCTATGCTCGAGCATAGCACCTTGCAGCAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007483.2-1711s21c1
Sequence:CCGGCCTGTCCTACAAATGAACATTCTCGAGAATGTTCATTTGTAGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007483.2-584s21c1
Sequence:CCGGCGACGTCATCCTTATGTGCTTCTCGAGAAGCACATAAGGATGACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007483.2-644s21c1
Sequence:CCGGGAAGTGGGTGCCCGAGGTAAACTCGAGTTTACCTCGGGCACCCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007483.2-800s21c1
Sequence:CCGGGCGCATCCAAGCCTATGACTACTCGAGTAGTCATAGGCTTGGATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007483
VALIDATED
RHOB MISSION shRNA Lentiviral Transduction Particles
ras homolog family member B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007483.2-584s1c1
Sequence:CCGGCGACGTCATCCTTATGTGCTTCTCGAGAAGCACATAAGGATGACGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007483.2-1711s1c1
Sequence:CCGGCCTGTCCTACAAATGAACATTCTCGAGAATGTTCATTTGTAGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007483.2-422s1c1
Sequence:CCGGCGTGTTCAGTAAAGACGAATTCTCGAGAATTCGTCTTTACTGAACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007483.2-540s1c1
Sequence:CCGGCAGGAGGACTACGATCGTTTACTCGAGTAAACGATCGTAGTCCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007483.2-459s1c1
Sequence:CCGGCCCACCGTGTTCGAGAACTATCTCGAGATAGTTCTCGAACACGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007483.2-923s21c1
Sequence:CCGGCAACTGCTGCAAGGTGCTATGCTCGAGCATAGCACCTTGCAGCAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007483.2-1711s21c1
Sequence:CCGGCCTGTCCTACAAATGAACATTCTCGAGAATGTTCATTTGTAGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007483.2-584s21c1
Sequence:CCGGCGACGTCATCCTTATGTGCTTCTCGAGAAGCACATAAGGATGACGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007483.2-644s21c1
Sequence:CCGGGAAGTGGGTGCCCGAGGTAAACTCGAGTTTACCTCGGGCACCCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007483.2-800s21c1
Sequence:CCGGGCGCATCCAAGCCTATGACTACTCGAGTAGTCATAGGCTTGGATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004040
RHOB MISSION shRNA Bacterial Glycerol Stock
ras homolog family member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004040.2-461s1c1
Sequence:CCGGCGTGTTCAGTAAGGACGAGTTCTCGAGAACTCGTCCTTACTGAACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004040.2-452s1c1
Sequence:CCGGCCTGCTGATCGTGTTCAGTAACTCGAGTTACTGAACACGATCAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004040.2-623s1c1
Sequence:CCGGCGACGTCATTCTCATGTGCTTCTCGAGAAGCACATGAGAATGACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004040.2-498s1c1
Sequence:CCGGCCCACCGTCTTCGAGAACTATCTCGAGATAGTTCTCGAAGACGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004040.2-839s1c1
Sequence:CCGGGCGCATCCAAGCCTACGACTACTCGAGTAGTCGTAGGCTTGGATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004040.2-962s21c1
Sequence:CCGGCAACTGCTGCAAGGTGCTATGCTCGAGCATAGCACCTTGCAGCAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004040.2-452s21c1
Sequence:CCGGCCTGCTGATCGTGTTCAGTAACTCGAGTTACTGAACACGATCAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004040.2-839s21c1
Sequence:CCGGGCGCATCCAAGCCTACGACTACTCGAGTAGTCGTAGGCTTGGATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004040.2-700s21c1
Sequence:CCGGTGAAGCACTTCTGTCCCAATGCTCGAGCATTGGGACAGAAGTGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004040
RHOB MISSION shRNA shRNA Plasmid DNA
ras homolog family member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004040.2-461s1c1
Sequence:CCGGCGTGTTCAGTAAGGACGAGTTCTCGAGAACTCGTCCTTACTGAACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004040.2-452s1c1
Sequence:CCGGCCTGCTGATCGTGTTCAGTAACTCGAGTTACTGAACACGATCAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004040.2-623s1c1
Sequence:CCGGCGACGTCATTCTCATGTGCTTCTCGAGAAGCACATGAGAATGACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004040.2-498s1c1
Sequence:CCGGCCCACCGTCTTCGAGAACTATCTCGAGATAGTTCTCGAAGACGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004040.2-839s1c1
Sequence:CCGGGCGCATCCAAGCCTACGACTACTCGAGTAGTCGTAGGCTTGGATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004040.2-962s21c1
Sequence:CCGGCAACTGCTGCAAGGTGCTATGCTCGAGCATAGCACCTTGCAGCAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004040.2-452s21c1
Sequence:CCGGCCTGCTGATCGTGTTCAGTAACTCGAGTTACTGAACACGATCAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004040.2-839s21c1
Sequence:CCGGGCGCATCCAAGCCTACGACTACTCGAGTAGTCGTAGGCTTGGATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004040.2-700s21c1
Sequence:CCGGTGAAGCACTTCTGTCCCAATGCTCGAGCATTGGGACAGAAGTGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004040
RHOB MISSION shRNA Lentiviral Transduction Particles
ras homolog family member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004040.2-461s1c1
Sequence:CCGGCGTGTTCAGTAAGGACGAGTTCTCGAGAACTCGTCCTTACTGAACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004040.2-452s1c1
Sequence:CCGGCCTGCTGATCGTGTTCAGTAACTCGAGTTACTGAACACGATCAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004040.2-623s1c1
Sequence:CCGGCGACGTCATTCTCATGTGCTTCTCGAGAAGCACATGAGAATGACGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004040.2-498s1c1
Sequence:CCGGCCCACCGTCTTCGAGAACTATCTCGAGATAGTTCTCGAAGACGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004040.2-839s1c1
Sequence:CCGGGCGCATCCAAGCCTACGACTACTCGAGTAGTCGTAGGCTTGGATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004040.2-962s21c1
Sequence:CCGGCAACTGCTGCAAGGTGCTATGCTCGAGCATAGCACCTTGCAGCAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004040.2-452s21c1
Sequence:CCGGCCTGCTGATCGTGTTCAGTAACTCGAGTTACTGAACACGATCAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004040.2-839s21c1
Sequence:CCGGGCGCATCCAAGCCTACGACTACTCGAGTAGTCGTAGGCTTGGATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004040.2-700s21c1
Sequence:CCGGTGAAGCACTTCTGTCCCAATGCTCGAGCATTGGGACAGAAGTGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)