EMAIL THIS PAGE TO A FRIEND

RHOBTB1

Rho-related BTB domain containing 1

306 Gene Product Result for
UniProtKB ID: O94844
Gene ID:
Human(9886) Summary: The protein encoded by this gene belongs to the Rho family of the small GTPase superfamily. It contains a GTPase domain, a proline-rich region, a tandem of 2 BTB (broad complex, tramtrack, and bric-a-brac) domains, and a conserved C-terminal region. The protein plays a role in small GTPase-mediated signal transduction and the organization of the actin filament system. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Mouse(69288) Rho-related BTB domain containing 1
Rat(309722) Rho-related BTB domain containing 1
Zebrafish(100537290) Rho-related BTB domain containing 1
domestic cat(101080740) Rho-related BTB domain containing 1
Horse(100062805) Rho-related BTB domain containing 1
dog(488998) Rho-related BTB domain containing 1
chicken(423664) Rho-related BTB domain containing 1
domestic guinea pig(100712847) Rho-related BTB domain containing 1
naked mole-rat(101716321) Rho-related BTB domain containing 1
cow(540513) Rho-related BTB domain containing 1
Goat(100861107) Rho-related BTB domain containing 1
sheep(101120983) Rho-related BTB domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014836 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081347 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081347 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081347 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032380 Rosetta Predictions human pricing
NM_014836 Rosetta Predictions human pricing
NM_198225 Rosetta Predictions human pricing
NM_001107622 Rosetta Predictions rat pricing
NM_001081347 Rosetta Predictions mouse pricing
XM_125637 Rosetta Predictions mouse pricing
XM_897523 Rosetta Predictions mouse pricing
XM_897555 Rosetta Predictions mouse pricing
XM_897566 Rosetta Predictions mouse pricing
XM_897577 Rosetta Predictions mouse pricing
XM_897586 Rosetta Predictions mouse pricing
XM_981394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138544 predicted 1836
2 SASI_Hs01_00138545 predicted 885
3 SASI_Hs01_00138546 predicted 450
4 SASI_Hs01_00138547 predicted 510
5 SASI_Hs01_00138549 predicted 1334
6 SASI_Hs01_00138550 predicted 2028
7 SASI_Hs01_00138552 predicted 806
8 SASI_Hs01_00138553 predicted 767
9 SASI_Hs02_00307923 predicted 1010
10 SASI_Hs02_00307924 predicted 2007
11 SASI_Hs01_00138548 predicted 2044
12 SASI_Hs01_00138551 predicted 1907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060799 predicted 1932
2 SASI_Hs01_00060800 predicted 970
3 SASI_Hs01_00060801 predicted 546
4 SASI_Hs01_00060802 predicted 595
5 SASI_Hs01_00060804 predicted 1420
6 SASI_Hs01_00060805 predicted 2120
7 SASI_Hs01_00060807 predicted 901
8 SASI_Hs01_00060808 predicted 853
9 SASI_Hs02_00346393 predicted 1105
10 SASI_Hs02_00346394 predicted 2098
11 SASI_Hs01_00060803 predicted 2129
12 SASI_Hs01_00060806 predicted 1994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074533 predicted 1842
2 SASI_Hs01_00074534 predicted 881
3 SASI_Hs01_00074535 predicted 460
4 SASI_Hs01_00074536 predicted 510
5 SASI_Hs01_00074538 predicted 1331
6 SASI_Hs01_00074539 predicted 2029
7 SASI_Hs01_00074541 predicted 810
8 SASI_Hs01_00074542 predicted 765
9 SASI_Hs02_00371755 predicted 1020
10 SASI_Hs02_00371756 predicted 2007
11 SASI_Hs01_00074537 predicted 2040
12 SASI_Hs01_00074540 predicted 1902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107622 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230645 predicted 2881
2 SASI_Rn02_00230646 predicted 2566
3 SASI_Rn02_00230647 predicted 1372
4 SASI_Rn02_00230648 predicted 1540
5 SASI_Rn02_00230649 predicted 2685
6 SASI_Rn02_00230650 predicted 2631
7 SASI_Rn02_00230651 predicted 1254
8 SASI_Rn02_00230652 predicted 1735
9 SASI_Rn02_00230653 predicted 2129
10 SASI_Rn02_00230654 predicted 2325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081347 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297521 predicted 2127
2 SASI_Mm02_00297522 predicted 1922
3 SASI_Mm02_00297523 predicted 1189
4 SASI_Mm02_00297524 predicted 1575
5 SASI_Mm02_00297525 predicted 778
6 SASI_Mm02_00297526 predicted 617
7 SASI_Mm02_00297527 predicted 2130
8 SASI_Mm02_00297528 predicted 498
9 SASI_Mm02_00297529 predicted 975
10 SASI_Mm02_00297530 predicted 2018
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_125637 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272326 predicted 2455
2 SASI_Mm01_00272327 predicted 1063
3 SASI_Mm01_00272328 predicted 2813
4 SASI_Mm01_00272329 predicted 2623
5 SASI_Mm01_00272330 predicted 2653
6 SASI_Mm01_00272331 predicted 1315
7 SASI_Mm01_00272332 predicted 1191
8 SASI_Mm01_00272333 predicted 985
9 SASI_Mm01_00272334 predicted 2326
10 SASI_Mm01_00272335 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248399 predicted 382
2 SASI_Mm01_00248400 predicted 620
3 SASI_Mm01_00248401 predicted 622
4 SASI_Mm01_00248402 predicted 434
5 SASI_Mm01_00248403 predicted 387
6 SASI_Mm01_00248404 predicted 502
7 SASI_Mm01_00248405 predicted 296
8 SASI_Mm01_00248406 predicted 404
9 SASI_Mm01_00248407 predicted 302
10 SASI_Mm01_00248408 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897555 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248275 predicted 1767
2 SASI_Mm01_00248276 predicted 377
3 SASI_Mm01_00248277 predicted 2126
4 SASI_Mm01_00248278 predicted 1933
5 SASI_Mm01_00248279 predicted 1971
6 SASI_Mm01_00248280 predicted 623
7 SASI_Mm01_00248281 predicted 506
8 SASI_Mm01_00248282 predicted 299
9 SASI_Mm01_00248283 predicted 1645
10 SASI_Mm01_00248284 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201914 predicted 1705
2 SASI_Mm01_00201915 predicted 2057
3 SASI_Mm01_00201916 predicted 2098
4 SASI_Mm01_00201917 predicted 1867
5 SASI_Mm01_00201918 predicted 1893
6 SASI_Mm01_00201919 predicted 2067
7 SASI_Mm01_00201920 predicted 1674
8 SASI_Mm01_00201921 predicted 2228
9 SASI_Mm01_00201922 predicted 1944
10 SASI_Mm01_00201923 predicted 1575
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233362 predicted 1066
2 SASI_Mm01_00233363 predicted 2395
3 SASI_Mm01_00233364 predicted 1312
4 SASI_Mm01_00233365 predicted 2402
5 SASI_Mm01_00233366 predicted 1317
6 SASI_Mm01_00233367 predicted 1194
7 SASI_Mm01_00233368 predicted 991
8 SASI_Mm01_00233369 predicted 2336
9 SASI_Mm01_00233370 predicted 1094
10 SASI_Mm01_00233371 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253072 predicted 1752
2 SASI_Mm01_00253073 predicted 366
3 SASI_Mm01_00253074 predicted 2118
4 SASI_Mm01_00253075 predicted 1912
5 SASI_Mm01_00253076 predicted 1945
6 SASI_Mm01_00253077 predicted 603
7 SASI_Mm01_00253078 predicted 482
8 SASI_Mm01_00253079 predicted 279
9 SASI_Mm01_00253080 predicted 1629
10 SASI_Mm01_00253081 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207890 predicted 1839
2 SASI_Mm01_00207891 predicted 449
3 SASI_Mm01_00207892 predicted 2199
4 SASI_Mm01_00207893 predicted 2002
5 SASI_Mm01_00207894 predicted 2040
6 SASI_Mm01_00207895 predicted 700
7 SASI_Mm01_00207896 predicted 571
8 SASI_Mm01_00207897 predicted 377
9 SASI_Mm01_00207898 predicted 1709
10 SASI_Mm01_00207899 predicted 478
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014836
VALIDATED
RHOBTB1 MISSION shRNA Bacterial Glycerol Stock
Rho-related BTB domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014836.4-1813s21c1
Sequence:CCGGACGTTCTCGGACGTGACATTTCTCGAGAAATGTCACGTCCGAGAACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014836.4-1197s21c1
Sequence:CCGGCATCTTTGCACATCGAATTTACTCGAGTAAATTCGATGTGCAAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014836.3-1118s1c1
Sequence:CCGGGCCGATGTTCTGTTCATCCTTCTCGAGAAGGATGAACAGAACATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014836.3-867s1c1
Sequence:CCGGGCTTACCATACTATGAAACAACTCGAGTTGTTTCATAGTATGGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014836.3-650s1c1
Sequence:CCGGGCTAATCCCAATTCCCTAAATCTCGAGATTTAGGGAATTGGGATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014836.3-1934s1c1
Sequence:CCGGGCAGTATTGGATTATCTCTATCTCGAGATAGAGATAATCCAATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014836.3-2205s1c1
Sequence:CCGGGCTCCAAGTTCCGTAAGGAAACTCGAGTTTCCTTACGGAACTTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014836
VALIDATED
RHOBTB1 MISSION shRNA shRNA Plasmid DNA
Rho-related BTB domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014836.4-1813s21c1
Sequence:CCGGACGTTCTCGGACGTGACATTTCTCGAGAAATGTCACGTCCGAGAACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014836.4-1197s21c1
Sequence:CCGGCATCTTTGCACATCGAATTTACTCGAGTAAATTCGATGTGCAAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014836.3-1118s1c1
Sequence:CCGGGCCGATGTTCTGTTCATCCTTCTCGAGAAGGATGAACAGAACATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014836.3-867s1c1
Sequence:CCGGGCTTACCATACTATGAAACAACTCGAGTTGTTTCATAGTATGGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014836.3-650s1c1
Sequence:CCGGGCTAATCCCAATTCCCTAAATCTCGAGATTTAGGGAATTGGGATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014836.3-1934s1c1
Sequence:CCGGGCAGTATTGGATTATCTCTATCTCGAGATAGAGATAATCCAATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014836.3-2205s1c1
Sequence:CCGGGCTCCAAGTTCCGTAAGGAAACTCGAGTTTCCTTACGGAACTTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014836
VALIDATED
RHOBTB1 MISSION shRNA Lentiviral Transduction Particles
Rho-related BTB domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014836.4-1813s21c1
Sequence:CCGGACGTTCTCGGACGTGACATTTCTCGAGAAATGTCACGTCCGAGAACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014836.4-1197s21c1
Sequence:CCGGCATCTTTGCACATCGAATTTACTCGAGTAAATTCGATGTGCAAAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014836.3-1118s1c1
Sequence:CCGGGCCGATGTTCTGTTCATCCTTCTCGAGAAGGATGAACAGAACATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014836.3-867s1c1
Sequence:CCGGGCTTACCATACTATGAAACAACTCGAGTTGTTTCATAGTATGGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014836.3-650s1c1
Sequence:CCGGGCTAATCCCAATTCCCTAAATCTCGAGATTTAGGGAATTGGGATTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014836.3-1934s1c1
Sequence:CCGGGCAGTATTGGATTATCTCTATCTCGAGATAGAGATAATCCAATACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014836.3-2205s1c1
Sequence:CCGGGCTCCAAGTTCCGTAAGGAAACTCGAGTTTCCTTACGGAACTTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081347
VALIDATED
RHOBTB1 MISSION shRNA Bacterial Glycerol Stock
Rho-related BTB domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-2270s21c1
Sequence:CCGGTGTTGACAGCTCTACTATAAACTCGAGTTTATAGTAGAGCTGTCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-971s21c1
Sequence:CCGGATCTTTGCGCACCGCATTTACCTCGAGGTAAATGCGGTGCGCAAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-693s21c1
Sequence:CCGGACTACGAGACCAGCGTGTTTGCTCGAGCAAACACGCTGGTCTCGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081347.1-611s21c1
Sequence:CCGGCCCTTAGCAAGGCCCATAAAGCTCGAGCTTTATGGGCCTTGCTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-2801s21c1
Sequence:CCGGGATGAGCCACGTTGGTATAATCTCGAGATTATACCAACGTGGCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081347.1-1583s21c1
Sequence:CCGGACCTTCTCAGACGTGACATTTCTCGAGAAATGTCACGTCTGAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-1708s21c1
Sequence:CCGGTGAGGTTCACCTCCCAAATATCTCGAGATATTTGGGAGGTGAACCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-1545s21c1
Sequence:CCGGGGAAAGCCAATCGGATCAAAGCTCGAGCTTTGATCCGATTGGCTTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-994s21c1
Sequence:CCGGCGCTACCTCTTCTTCCAAATTCTCGAGAATTTGGAAGAAGAGGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081347
VALIDATED
RHOBTB1 MISSION shRNA shRNA Plasmid DNA
Rho-related BTB domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-2270s21c1
Sequence:CCGGTGTTGACAGCTCTACTATAAACTCGAGTTTATAGTAGAGCTGTCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-971s21c1
Sequence:CCGGATCTTTGCGCACCGCATTTACCTCGAGGTAAATGCGGTGCGCAAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-693s21c1
Sequence:CCGGACTACGAGACCAGCGTGTTTGCTCGAGCAAACACGCTGGTCTCGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081347.1-611s21c1
Sequence:CCGGCCCTTAGCAAGGCCCATAAAGCTCGAGCTTTATGGGCCTTGCTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-2801s21c1
Sequence:CCGGGATGAGCCACGTTGGTATAATCTCGAGATTATACCAACGTGGCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081347.1-1583s21c1
Sequence:CCGGACCTTCTCAGACGTGACATTTCTCGAGAAATGTCACGTCTGAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-1708s21c1
Sequence:CCGGTGAGGTTCACCTCCCAAATATCTCGAGATATTTGGGAGGTGAACCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-1545s21c1
Sequence:CCGGGGAAAGCCAATCGGATCAAAGCTCGAGCTTTGATCCGATTGGCTTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-994s21c1
Sequence:CCGGCGCTACCTCTTCTTCCAAATTCTCGAGAATTTGGAAGAAGAGGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081347
VALIDATED
RHOBTB1 MISSION shRNA Lentiviral Transduction Particles
Rho-related BTB domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-2270s21c1
Sequence:CCGGTGTTGACAGCTCTACTATAAACTCGAGTTTATAGTAGAGCTGTCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-971s21c1
Sequence:CCGGATCTTTGCGCACCGCATTTACCTCGAGGTAAATGCGGTGCGCAAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-693s21c1
Sequence:CCGGACTACGAGACCAGCGTGTTTGCTCGAGCAAACACGCTGGTCTCGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081347.1-611s21c1
Sequence:CCGGCCCTTAGCAAGGCCCATAAAGCTCGAGCTTTATGGGCCTTGCTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-2801s21c1
Sequence:CCGGGATGAGCCACGTTGGTATAATCTCGAGATTATACCAACGTGGCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081347.1-1583s21c1
Sequence:CCGGACCTTCTCAGACGTGACATTTCTCGAGAAATGTCACGTCTGAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-1708s21c1
Sequence:CCGGTGAGGTTCACCTCCCAAATATCTCGAGATATTTGGGAGGTGAACCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-1545s21c1
Sequence:CCGGGGAAAGCCAATCGGATCAAAGCTCGAGCTTTGATCCGATTGGCTTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081347.1-994s21c1
Sequence:CCGGCGCTACCTCTTCTTCCAAATTCTCGAGAATTTGGAAGAAGAGGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)