EMAIL THIS PAGE TO A FRIEND

RHOC

ras homolog family member C

72 Gene Product Result for
Synonyms: ARH9 ARHC H9 RHOH9
UniProtKB ID: P08134, B3KSW1, Q6ICN3
Gene ID:
Human(389) Summary: This gene encodes a member of the Rho family of small GTPases, which cycle between inactive GDP-bound and active GTP-bound states and function as molecular switches in signal transduction cascades. Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. The protein encoded by this gene is prenylated at its C-terminus, and localizes to the cytoplasm and plasma membrane. It is thought to be important in cell locomotion. Overexpression of this gene is associated with tumor cell proliferation and metastasis. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
Mouse(11853) ras homolog gene family, member C
Rat(295342) ras homolog family member C
cow(513152) ras homolog gene family, member C
sheep(101118144) ras homolog family member C
naked mole-rat(101706654) ras homolog family member C
domestic guinea pig(100715557) ras homolog family member C
chicken(395869) ras homolog gene family, member C
domestic cat(101098319) ras homolog family member C
dog(483218) ras homolog family member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175744 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175744 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175744 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007484 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007484 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007484 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042678 Rosetta Predictions human pricing
NM_001042679 Rosetta Predictions human pricing
NM_175744 Rosetta Predictions human pricing
NM_001106461 Rosetta Predictions rat pricing
NM_007484 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310923 predicted 776
2 SASI_Hs02_00310924 predicted 782
3 SASI_Hs02_00310925 predicted 766
4 SASI_Hs02_00310926 predicted 556
5 SASI_Hs02_00310927 predicted 774
6 SASI_Hs02_00310928 predicted 710
7 SASI_Hs02_00310929 predicted 1097
8 SASI_Hs02_00310930 predicted 709
9 SASI_Hs02_00310931 predicted 767
10 SASI_Hs02_00310932 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310933 predicted 747
2 SASI_Hs02_00310934 predicted 747
3 SASI_Hs02_00310935 predicted 730
4 SASI_Hs02_00310936 predicted 520
5 SASI_Hs02_00310937 predicted 739
6 SASI_Hs02_00310938 predicted 685
7 SASI_Hs02_00310939 predicted 1070
8 SASI_Hs02_00310940 predicted 680
9 SASI_Hs02_00310941 predicted 728
10 SASI_Hs02_00310942 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014994 predicted 846
2 SASI_Hs01_00014996 predicted 849
3 SASI_Hs01_00014998 predicted 828
4 SASI_Hs01_00015000 predicted 623
5 SASI_Hs01_00015003 predicted 842
6 SASI_Hs02_00369097 predicted 783
7 SASI_Hs02_00369098 predicted 1173
8 SASI_Hs02_00369099 predicted 778
9 SASI_Hs02_00369100 predicted 829
10 SASI_Hs02_00369101 predicted 821
11 SASI_Hs01_00014995 predicted 199
12 SASI_Hs01_00014997 predicted 279
13 SASI_Hs01_00014999 predicted 218
14 SASI_Hs01_00015001 predicted 203
15 SASI_Hs01_00015002 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106461 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219188 predicted 271
2 SASI_Rn02_00219189 predicted 362
3 SASI_Rn02_00219190 predicted 357
4 SASI_Rn02_00219191 predicted 289
5 SASI_Rn02_00219192 predicted 368
6 SASI_Rn02_00219193 predicted 398
7 SASI_Rn02_00219194 predicted 498
8 SASI_Rn02_00219195 predicted 311
9 SASI_Rn02_00219196 predicted 364
10 SASI_Rn02_00219197 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049623 predicted 506
2 SASI_Mm01_00049624 predicted 285
3 SASI_Mm01_00049625 predicted 589
4 SASI_Mm01_00049626 predicted 585
5 SASI_Mm01_00049627 predicted 710
6 SASI_Mm01_00049628 predicted 589
7 SASI_Mm01_00049629 predicted 274
8 SASI_Mm01_00049630 predicted 509
9 SASI_Mm01_00049631 predicted 291
10 SASI_Mm01_00049632 predicted 700
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175744
VALIDATED
RHOC MISSION shRNA Bacterial Glycerol Stock
ras homolog family member C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_175744.3-204s1c1
Sequence:CCGGCTACTGTCTTTGAGAACTATACTCGAGTATAGTTCTCAAAGACAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_175744.3-328s1c1
Sequence:CCGGTGATGTCATCCTCATGTGCTTCTCGAGAAGCACATGAGGATGACATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_175744.3-445s1c1
Sequence:CCGGGAATAAGAAGGACCTGAGGCACTCGAGTGCCTCAGGTCCTTCTTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_175744.3-539s1c1
Sequence:CCGGGCGAACCGGATCAGTGCCTTTCTCGAGAAAGGCACTGATCCGGTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_175744.4-509s21c1
Sequence:CCGGCTACTGTCTTTGAGAACTATACTCGAGTATAGTTCTCAAAGACAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_175744.4-520s21c1
Sequence:CCGGGAGAACTATATTGCGGACATTCTCGAGAATGTCCGCAATATAGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175744.4-750s21c1
Sequence:CCGGGAATAAGAAGGACCTGAGGCACTCGAGTGCCTCAGGTCCTTCTTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_175744.4-844s21c1
Sequence:CCGGGCGAACCGGATCAGTGCCTTTCTCGAGAAAGGCACTGATCCGGTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_175744.4-633s21c1
Sequence:CCGGTGATGTCATCCTCATGTGCTTCTCGAGAAGCACATGAGGATGACATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175744
VALIDATED
RHOC MISSION shRNA shRNA Plasmid DNA
ras homolog family member C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_175744.3-204s1c1
Sequence:CCGGCTACTGTCTTTGAGAACTATACTCGAGTATAGTTCTCAAAGACAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_175744.3-328s1c1
Sequence:CCGGTGATGTCATCCTCATGTGCTTCTCGAGAAGCACATGAGGATGACATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_175744.3-445s1c1
Sequence:CCGGGAATAAGAAGGACCTGAGGCACTCGAGTGCCTCAGGTCCTTCTTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_175744.3-539s1c1
Sequence:CCGGGCGAACCGGATCAGTGCCTTTCTCGAGAAAGGCACTGATCCGGTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_175744.4-509s21c1
Sequence:CCGGCTACTGTCTTTGAGAACTATACTCGAGTATAGTTCTCAAAGACAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_175744.4-520s21c1
Sequence:CCGGGAGAACTATATTGCGGACATTCTCGAGAATGTCCGCAATATAGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175744.4-750s21c1
Sequence:CCGGGAATAAGAAGGACCTGAGGCACTCGAGTGCCTCAGGTCCTTCTTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_175744.4-844s21c1
Sequence:CCGGGCGAACCGGATCAGTGCCTTTCTCGAGAAAGGCACTGATCCGGTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_175744.4-633s21c1
Sequence:CCGGTGATGTCATCCTCATGTGCTTCTCGAGAAGCACATGAGGATGACATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175744
VALIDATED
RHOC MISSION shRNA Lentiviral Transduction Particles
ras homolog family member C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_175744.3-204s1c1
Sequence:CCGGCTACTGTCTTTGAGAACTATACTCGAGTATAGTTCTCAAAGACAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_175744.3-328s1c1
Sequence:CCGGTGATGTCATCCTCATGTGCTTCTCGAGAAGCACATGAGGATGACATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_175744.3-445s1c1
Sequence:CCGGGAATAAGAAGGACCTGAGGCACTCGAGTGCCTCAGGTCCTTCTTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_175744.3-539s1c1
Sequence:CCGGGCGAACCGGATCAGTGCCTTTCTCGAGAAAGGCACTGATCCGGTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_175744.4-509s21c1
Sequence:CCGGCTACTGTCTTTGAGAACTATACTCGAGTATAGTTCTCAAAGACAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_175744.4-520s21c1
Sequence:CCGGGAGAACTATATTGCGGACATTCTCGAGAATGTCCGCAATATAGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175744.4-750s21c1
Sequence:CCGGGAATAAGAAGGACCTGAGGCACTCGAGTGCCTCAGGTCCTTCTTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_175744.4-844s21c1
Sequence:CCGGGCGAACCGGATCAGTGCCTTTCTCGAGAAAGGCACTGATCCGGTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_175744.4-633s21c1
Sequence:CCGGTGATGTCATCCTCATGTGCTTCTCGAGAAGCACATGAGGATGACATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007484
VALIDATED
RHOC MISSION shRNA Bacterial Glycerol Stock
ras homolog family member C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007484.1-688s1c1
Sequence:CCGGGCCATCCTTGTAGGACTCCATCTCGAGATGGAGTCCTACAAGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007484.1-277s1c1
Sequence:CCGGCATCCTCATGTGTTTCTCCATCTCGAGATGGAGAAACACATGAGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007484.1-399s1c1
Sequence:CCGGACCTGAGGCAAGATGAGCATACTCGAGTATGCTCATCTTGCCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007484.1-172s1c1
Sequence:CCGGCGACATCGAAGTGGATGGCAACTCGAGTTGCCATCCACTTCGATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007484.1-149s1c1
Sequence:CCGGACCGTCTTTGAGAACTATATACTCGAGTATATAGTTCTCAAAGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007484.2-417s21c1
Sequence:CCGGACCTGAGGCAAGATGAGCATACTCGAGTATGCTCATCTTGCCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007484.2-706s21c1
Sequence:CCGGGCCATCCTTGTAGGACTCCATCTCGAGATGGAGTCCTACAAGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007484.2-167s21c1
Sequence:CCGGACCGTCTTTGAGAACTATATACTCGAGTATATAGTTCTCAAAGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007484.2-376s21c1
Sequence:CCGGTTGTCCCAACGTGCCCATCATCTCGAGATGATGGGCACGTTGGGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007484.2-129s21c1
Sequence:CCGGTCTTCAGCAAAGATCAGTTTCCTCGAGGAAACTGATCTTTGCTGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007484
VALIDATED
RHOC MISSION shRNA shRNA Plasmid DNA
ras homolog family member C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007484.1-688s1c1
Sequence:CCGGGCCATCCTTGTAGGACTCCATCTCGAGATGGAGTCCTACAAGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007484.1-277s1c1
Sequence:CCGGCATCCTCATGTGTTTCTCCATCTCGAGATGGAGAAACACATGAGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007484.1-399s1c1
Sequence:CCGGACCTGAGGCAAGATGAGCATACTCGAGTATGCTCATCTTGCCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007484.1-172s1c1
Sequence:CCGGCGACATCGAAGTGGATGGCAACTCGAGTTGCCATCCACTTCGATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007484.1-149s1c1
Sequence:CCGGACCGTCTTTGAGAACTATATACTCGAGTATATAGTTCTCAAAGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007484.2-417s21c1
Sequence:CCGGACCTGAGGCAAGATGAGCATACTCGAGTATGCTCATCTTGCCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007484.2-706s21c1
Sequence:CCGGGCCATCCTTGTAGGACTCCATCTCGAGATGGAGTCCTACAAGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007484.2-167s21c1
Sequence:CCGGACCGTCTTTGAGAACTATATACTCGAGTATATAGTTCTCAAAGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007484.2-376s21c1
Sequence:CCGGTTGTCCCAACGTGCCCATCATCTCGAGATGATGGGCACGTTGGGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007484.2-129s21c1
Sequence:CCGGTCTTCAGCAAAGATCAGTTTCCTCGAGGAAACTGATCTTTGCTGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007484
VALIDATED
RHOC MISSION shRNA Lentiviral Transduction Particles
ras homolog family member C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007484.1-688s1c1
Sequence:CCGGGCCATCCTTGTAGGACTCCATCTCGAGATGGAGTCCTACAAGGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007484.1-277s1c1
Sequence:CCGGCATCCTCATGTGTTTCTCCATCTCGAGATGGAGAAACACATGAGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007484.1-399s1c1
Sequence:CCGGACCTGAGGCAAGATGAGCATACTCGAGTATGCTCATCTTGCCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007484.1-172s1c1
Sequence:CCGGCGACATCGAAGTGGATGGCAACTCGAGTTGCCATCCACTTCGATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007484.1-149s1c1
Sequence:CCGGACCGTCTTTGAGAACTATATACTCGAGTATATAGTTCTCAAAGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007484.2-417s21c1
Sequence:CCGGACCTGAGGCAAGATGAGCATACTCGAGTATGCTCATCTTGCCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007484.2-706s21c1
Sequence:CCGGGCCATCCTTGTAGGACTCCATCTCGAGATGGAGTCCTACAAGGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007484.2-167s21c1
Sequence:CCGGACCGTCTTTGAGAACTATATACTCGAGTATATAGTTCTCAAAGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007484.2-376s21c1
Sequence:CCGGTTGTCCCAACGTGCCCATCATCTCGAGATGATGGGCACGTTGGGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007484.2-129s21c1
Sequence:CCGGTCTTCAGCAAAGATCAGTTTCCTCGAGGAAACTGATCTTTGCTGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)