EMAIL THIS PAGE TO A FRIEND

RHOF

ras homolog family member F (in filopodia)

37 Gene Product Result for
Synonyms: ARHF RIF
UniProtKB ID: Q9HBH0, Q8WVB1, Q9NXH6
Gene ID:
Mouse(23912) ras homolog gene family, member f
cow(617894) ras homolog gene family, member F (in filopodia)
sheep(100147794) ras homolog family member F (in filopodia)
naked mole-rat(101701092) ras homolog family member F (in filopodia)
domestic guinea pig(100715196) ras homolog family member F (in filopodia)
Zebrafish(573655) ras homolog gene family, member F
domestic cat(101093718) ras homolog family member F (in filopodia)
dog(610807) ras homolog family member F (in filopodia)
chicken(416848) ras homolog family member F (in filopodia)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019034 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175092 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175092 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175092 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019034 Rosetta Predictions human pricing
NM_175092 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122478 predicted 1099
2 SASI_Hs01_00122479 predicted 425
3 SASI_Hs01_00122480 predicted 202
4 SASI_Hs01_00122481 predicted 916
5 SASI_Hs01_00122482 predicted 812
6 SASI_Hs01_00122483 predicted 621
7 SASI_Hs01_00122484 predicted 696
8 SASI_Hs01_00122485 predicted 350
9 SASI_Hs01_00122486 predicted 1104
10 SASI_Hs01_00122487 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175092 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153508 predicted 894
2 SASI_Mm01_00153509 predicted 427
3 SASI_Mm01_00153510 predicted 1000
4 SASI_Mm01_00153511 predicted 730
5 SASI_Mm01_00153512 predicted 347
6 SASI_Mm01_00153513 predicted 744
7 SASI_Mm02_00345675 predicted 1140
8 SASI_Mm01_00153514 predicted 375
9 SASI_Mm01_00153515 predicted 1260
10 SASI_Mm01_00153516 predicted 770
11 SASI_Mm01_00153517 predicted 748
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019034
VALIDATED
RHOF MISSION shRNA Bacterial Glycerol Stock
ras homolog family member F (in filopodia)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_019034.2-565s1c1
Sequence:CCGGCCTGGAATGTTCCGCCAAGTTCTCGAGAACTTGGCGGAACATTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_019034.2-376s1c1
Sequence:CCGGCAACGTCCTCATCAAGTGGTTCTCGAGAACCACTTGATGAGGACGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_019034.2-99s1c1
Sequence:CCGGCGGGCAGGAAGGAGCTGAAGACTCGAGTCTTCAGCTCCTTCCTGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_019034.2-337s1c1
Sequence:CCGGGCTCATCTGCTATGACGTCATCTCGAGATGACGTCATAGCAGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019034.2-565s21c1
Sequence:CCGGCCTGGAATGTTCCGCCAAGTTCTCGAGAACTTGGCGGAACATTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019034.2-337s21c1
Sequence:CCGGGCTCATCTGCTATGACGTCATCTCGAGATGACGTCATAGCAGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019034.2-376s21c1
Sequence:CCGGCAACGTCCTCATCAAGTGGTTCTCGAGAACCACTTGATGAGGACGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019034.2-99s21c1
Sequence:CCGGCGGGCAGGAAGGAGCTGAAGACTCGAGTCTTCAGCTCCTTCCTGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019034
VALIDATED
RHOF MISSION shRNA shRNA Plasmid DNA
ras homolog family member F (in filopodia)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_019034.2-565s1c1
Sequence:CCGGCCTGGAATGTTCCGCCAAGTTCTCGAGAACTTGGCGGAACATTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_019034.2-376s1c1
Sequence:CCGGCAACGTCCTCATCAAGTGGTTCTCGAGAACCACTTGATGAGGACGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_019034.2-99s1c1
Sequence:CCGGCGGGCAGGAAGGAGCTGAAGACTCGAGTCTTCAGCTCCTTCCTGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_019034.2-337s1c1
Sequence:CCGGGCTCATCTGCTATGACGTCATCTCGAGATGACGTCATAGCAGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019034.2-565s21c1
Sequence:CCGGCCTGGAATGTTCCGCCAAGTTCTCGAGAACTTGGCGGAACATTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019034.2-337s21c1
Sequence:CCGGGCTCATCTGCTATGACGTCATCTCGAGATGACGTCATAGCAGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019034.2-376s21c1
Sequence:CCGGCAACGTCCTCATCAAGTGGTTCTCGAGAACCACTTGATGAGGACGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019034.2-99s21c1
Sequence:CCGGCGGGCAGGAAGGAGCTGAAGACTCGAGTCTTCAGCTCCTTCCTGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019034
VALIDATED
RHOF MISSION shRNA Lentiviral Transduction Particles
ras homolog family member F (in filopodia)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_019034.2-565s1c1
Sequence:CCGGCCTGGAATGTTCCGCCAAGTTCTCGAGAACTTGGCGGAACATTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_019034.2-376s1c1
Sequence:CCGGCAACGTCCTCATCAAGTGGTTCTCGAGAACCACTTGATGAGGACGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_019034.2-99s1c1
Sequence:CCGGCGGGCAGGAAGGAGCTGAAGACTCGAGTCTTCAGCTCCTTCCTGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_019034.2-337s1c1
Sequence:CCGGGCTCATCTGCTATGACGTCATCTCGAGATGACGTCATAGCAGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019034.2-565s21c1
Sequence:CCGGCCTGGAATGTTCCGCCAAGTTCTCGAGAACTTGGCGGAACATTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019034.2-337s21c1
Sequence:CCGGGCTCATCTGCTATGACGTCATCTCGAGATGACGTCATAGCAGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019034.2-376s21c1
Sequence:CCGGCAACGTCCTCATCAAGTGGTTCTCGAGAACCACTTGATGAGGACGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019034.2-99s21c1
Sequence:CCGGCGGGCAGGAAGGAGCTGAAGACTCGAGTCTTCAGCTCCTTCCTGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175092
RHOF MISSION shRNA Bacterial Glycerol Stock
ras homolog family member F (in filopodia)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175092.2-3621s1c1
Sequence:CCGGCCCTTGATATTTAGGCCAAATCTCGAGATTTGGCCTAAATATCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175092.2-80s1c1
Sequence:CCGGGAGCTGAAGATAGTGATCGTACTCGAGTACGATCACTATCTTCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175092.2-545s1c1
Sequence:CCGGTCTGCCAAGTTTCGGGAGAATCTCGAGATTCTCCCGAAACTTGGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175092.2-337s1c1
Sequence:CCGGCAGTTACGACAACGTCCTCATCTCGAGATGAGGACGTTGTCGTAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175092.3-370s21c1
Sequence:CCGGTGTACTGCCAAGGCTCATTTCCTCGAGGAAATGAGCCTTGGCAGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175092.3-905s21c1
Sequence:CCGGGAGGGCCTGACTGGAACTATTCTCGAGAATAGTTCCAGTCAGGCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175092.3-698s21c1
Sequence:CCGGAGCTCAGCTGGAGCCTATTACCTCGAGGTAATAGGCTCCAGCTGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175092.3-748s21c1
Sequence:CCGGAGATGCGAGGTGCACTCTATCCTCGAGGATAGAGTGCACCTCGCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175092
RHOF MISSION shRNA shRNA Plasmid DNA
ras homolog family member F (in filopodia)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175092.2-3621s1c1
Sequence:CCGGCCCTTGATATTTAGGCCAAATCTCGAGATTTGGCCTAAATATCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175092.2-80s1c1
Sequence:CCGGGAGCTGAAGATAGTGATCGTACTCGAGTACGATCACTATCTTCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175092.2-545s1c1
Sequence:CCGGTCTGCCAAGTTTCGGGAGAATCTCGAGATTCTCCCGAAACTTGGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175092.2-337s1c1
Sequence:CCGGCAGTTACGACAACGTCCTCATCTCGAGATGAGGACGTTGTCGTAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175092.3-370s21c1
Sequence:CCGGTGTACTGCCAAGGCTCATTTCCTCGAGGAAATGAGCCTTGGCAGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175092.3-905s21c1
Sequence:CCGGGAGGGCCTGACTGGAACTATTCTCGAGAATAGTTCCAGTCAGGCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175092.3-698s21c1
Sequence:CCGGAGCTCAGCTGGAGCCTATTACCTCGAGGTAATAGGCTCCAGCTGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175092.3-748s21c1
Sequence:CCGGAGATGCGAGGTGCACTCTATCCTCGAGGATAGAGTGCACCTCGCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175092
RHOF MISSION shRNA Lentiviral Transduction Particles
ras homolog family member F (in filopodia)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175092.2-3621s1c1
Sequence:CCGGCCCTTGATATTTAGGCCAAATCTCGAGATTTGGCCTAAATATCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175092.2-80s1c1
Sequence:CCGGGAGCTGAAGATAGTGATCGTACTCGAGTACGATCACTATCTTCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175092.2-545s1c1
Sequence:CCGGTCTGCCAAGTTTCGGGAGAATCTCGAGATTCTCCCGAAACTTGGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175092.2-337s1c1
Sequence:CCGGCAGTTACGACAACGTCCTCATCTCGAGATGAGGACGTTGTCGTAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175092.3-370s21c1
Sequence:CCGGTGTACTGCCAAGGCTCATTTCCTCGAGGAAATGAGCCTTGGCAGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175092.3-905s21c1
Sequence:CCGGGAGGGCCTGACTGGAACTATTCTCGAGAATAGTTCCAGTCAGGCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175092.3-698s21c1
Sequence:CCGGAGCTCAGCTGGAGCCTATTACCTCGAGGTAATAGGCTCCAGCTGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175092.3-748s21c1
Sequence:CCGGAGATGCGAGGTGCACTCTATCCTCGAGGATAGAGTGCACCTCGCATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)