EMAIL THIS PAGE TO A FRIEND

RHOG

ras homolog family member G

112 Gene Product Result for
Synonyms: ARHG
UniProtKB ID: P84095, P35238, Q8NI04
Gene ID:
Human(391) Summary: This gene encodes a member of the Rho family of small GTPases, which cycle between inactive GDP-bound and active GTP-bound states and function as molecular switches in signal transduction cascades. Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. The encoded protein facilitates translocation of a functional guanine nucleotide exchange factor (GEF) complex from the cytoplasm to the plasma membrane where ras-related C3 botulinum toxin substrate 1 is activated to promote lamellipodium formation and cell migration. Two related pseudogene have been identified on chromosomes 20 and X. [provided by RefSeq, Aug 2011]
Mouse(56212) ras homolog gene family, member G
Rat(308875) ras homolog family member G
chicken(422207) ras homolog family member G
domestic cat(101087520) ras homolog family member G
dog(485217) ras homolog family member G
domestic guinea pig(100727913) ras homolog family member G
naked mole-rat(101706823) ras homolog family member G
cow(538559) ras homolog gene family, member G (rho G)
sheep(101116859) ras homolog family member G
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019566 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019566 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019566 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001665 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001665 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001665 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120671 MISSION® esiRNA esiRNA human RHOG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001665 Rosetta Predictions human pricing
NM_001037195 Rosetta Predictions rat pricing
NM_019566 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220291 predicted 937
2 SASI_Hs01_00220292 predicted 286
3 SASI_Hs01_00220295 predicted 933
4 SASI_Hs02_00332291 predicted 517
5 SASI_Hs02_00332292 predicted 934
6 SASI_Hs01_00220287 predicted 693
7 SASI_Hs01_00220288 predicted 433
8 SASI_Hs01_00220289 predicted 783
9 SASI_Hs01_00220290 predicted 1019
10 SASI_Hs01_00220293 predicted 931
11 SASI_Hs01_00220286 predicted 1022
12 SASI_Hs01_00220294 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037195 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076862 predicted 880
2 SASI_Rn01_00076863 predicted 675
3 SASI_Rn01_00076864 predicted 611
4 SASI_Rn02_00204292 predicted 981
5 SASI_Rn01_00076866 predicted 308
6 SASI_Rn01_00076867 predicted 629
7 SASI_Rn01_00076868 predicted 883
8 SASI_Rn01_00076869 predicted 779
9 SASI_Rn01_00076870 predicted 220
10 SASI_Rn01_00076871 predicted 470
11 SASI_Rn01_00076865 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324605 predicted 665
2 SASI_Mm02_00324606 predicted 530
3 SASI_Mm02_00324607 predicted 716
4 SASI_Mm01_00022037 predicted 274
5 SASI_Mm02_00324608 predicted 680
6 SASI_Mm01_00022039 predicted 269
7 SASI_Mm02_00324609 predicted 715
8 SASI_Mm02_00324610 predicted 521
9 SASI_Mm01_00022040 predicted 972
10 SASI_Mm02_00324611 predicted 417
11 SASI_Mm01_00022034 predicted 1008
12 SASI_Mm01_00022035 predicted 224
13 SASI_Mm01_00022036 predicted 984
14 SASI_Mm01_00022038 predicted 253
15 SASI_Mm01_00022041 predicted 1003
16 SASI_Mm01_00022042 predicted 489
17 SASI_Mm01_00022043 predicted 341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019566
VALIDATED
RHOG MISSION shRNA Bacterial Glycerol Stock
ras homolog family member G
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019566.3-435s21c1
Sequence:CCGGACCCAGAGGTTTGTCACCACTCTCGAGAGTGGTGACAAACCTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019566.2-345s1c2
Sequence:CCGGCAACGTCTTCGTCATCTGTTTCTCGAGAAACAGATGACGAAGACGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019566.3-917s21c1
Sequence:CCGGTATTCCATGAGTTCAACTAAGCTCGAGCTTAGTTGAACTCATGGAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019566.3-792s21c1
Sequence:CCGGCTGTGCCTTAAGGACTAATTCCTCGAGGAATTAGTCCTTAAGGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019566.3-671s21c1
Sequence:CCGGCTTAACCCAACACCGATAAAGCTCGAGCTTTATCGGTGTTGGGTTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019566.3-411s21c1
Sequence:CCGGATGAGAACGTGAGGCACAAATCTCGAGATTTGTGCCTCACGTTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019566.3-283s21c1
Sequence:CCGGTGGGCGCACCGTGAACCTAAACTCGAGTTTAGGTTCACGGTGCGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019566.3-586s21c1
Sequence:CCGGGATCCATGCTGTGCGCTACCTCTCGAGAGGTAGCGCACAGCATGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019566.2-987s1c1
Sequence:CCGGCCAAAGTTGTTGCTGCCTATTCTCGAGAATAGGCAGCAACAACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019566.2-607s1c1
Sequence:CCGGGACGGCGTCAAGGAGGTGTTTCTCGAGAAACACCTCCTTGACGCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019566.2-183s1c1
Sequence:CCGGCTGCTATACAACTAACGCCTTCTCGAGAAGGCGTTAGTTGTATAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019566.2-221s1c1
Sequence:CCGGCCACTGTGTTTGACAATTACACTCGAGTGTAATTGTCAAACACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019566
VALIDATED
RHOG MISSION shRNA shRNA Plasmid DNA
ras homolog family member G
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019566.3-435s21c1
Sequence:CCGGACCCAGAGGTTTGTCACCACTCTCGAGAGTGGTGACAAACCTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019566.2-345s1c2
Sequence:CCGGCAACGTCTTCGTCATCTGTTTCTCGAGAAACAGATGACGAAGACGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019566.3-917s21c1
Sequence:CCGGTATTCCATGAGTTCAACTAAGCTCGAGCTTAGTTGAACTCATGGAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019566.3-792s21c1
Sequence:CCGGCTGTGCCTTAAGGACTAATTCCTCGAGGAATTAGTCCTTAAGGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019566.3-671s21c1
Sequence:CCGGCTTAACCCAACACCGATAAAGCTCGAGCTTTATCGGTGTTGGGTTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019566.3-411s21c1
Sequence:CCGGATGAGAACGTGAGGCACAAATCTCGAGATTTGTGCCTCACGTTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019566.3-283s21c1
Sequence:CCGGTGGGCGCACCGTGAACCTAAACTCGAGTTTAGGTTCACGGTGCGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019566.3-586s21c1
Sequence:CCGGGATCCATGCTGTGCGCTACCTCTCGAGAGGTAGCGCACAGCATGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019566.2-987s1c1
Sequence:CCGGCCAAAGTTGTTGCTGCCTATTCTCGAGAATAGGCAGCAACAACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019566.2-607s1c1
Sequence:CCGGGACGGCGTCAAGGAGGTGTTTCTCGAGAAACACCTCCTTGACGCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019566.2-183s1c1
Sequence:CCGGCTGCTATACAACTAACGCCTTCTCGAGAAGGCGTTAGTTGTATAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019566.2-221s1c1
Sequence:CCGGCCACTGTGTTTGACAATTACACTCGAGTGTAATTGTCAAACACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019566
VALIDATED
RHOG MISSION shRNA Lentiviral Transduction Particles
ras homolog family member G
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019566.3-435s21c1
Sequence:CCGGACCCAGAGGTTTGTCACCACTCTCGAGAGTGGTGACAAACCTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019566.2-345s1c2
Sequence:CCGGCAACGTCTTCGTCATCTGTTTCTCGAGAAACAGATGACGAAGACGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019566.3-917s21c1
Sequence:CCGGTATTCCATGAGTTCAACTAAGCTCGAGCTTAGTTGAACTCATGGAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019566.3-792s21c1
Sequence:CCGGCTGTGCCTTAAGGACTAATTCCTCGAGGAATTAGTCCTTAAGGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019566.3-671s21c1
Sequence:CCGGCTTAACCCAACACCGATAAAGCTCGAGCTTTATCGGTGTTGGGTTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019566.3-411s21c1
Sequence:CCGGATGAGAACGTGAGGCACAAATCTCGAGATTTGTGCCTCACGTTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019566.3-283s21c1
Sequence:CCGGTGGGCGCACCGTGAACCTAAACTCGAGTTTAGGTTCACGGTGCGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019566.3-586s21c1
Sequence:CCGGGATCCATGCTGTGCGCTACCTCTCGAGAGGTAGCGCACAGCATGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019566.2-987s1c1
Sequence:CCGGCCAAAGTTGTTGCTGCCTATTCTCGAGAATAGGCAGCAACAACTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019566.2-607s1c1
Sequence:CCGGGACGGCGTCAAGGAGGTGTTTCTCGAGAAACACCTCCTTGACGCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019566.2-183s1c1
Sequence:CCGGCTGCTATACAACTAACGCCTTCTCGAGAAGGCGTTAGTTGTATAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019566.2-221s1c1
Sequence:CCGGCCACTGTGTTTGACAATTACACTCGAGTGTAATTGTCAAACACAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001665
RHOG MISSION shRNA Bacterial Glycerol Stock
ras homolog family member G
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001665.2-192s1c1
Sequence:CCGGCTGCTACACAACTAACGCTTTCTCGAGAAAGCGTTAGTTGTGTAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001665.2-324s1c1
Sequence:CCGGCCGCCTCCGTACACTCTCCTACTCGAGTAGGAGAGTGTACGGAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001665.2-616s1c1
Sequence:CCGGGATGGTGTCAAGGAAGTGTTCCTCGAGGAACACTTCCTTGACACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001665.2-273s1c1
Sequence:CCGGGCGCACAGTGAACCTGAACCTCTCGAGAGGTTCAGGTTCACTGTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001665.2-395s1c1
Sequence:CCGGCCTATGAGAACGTGCGGCACACTCGAGTGTGCCGCACGTTCTCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001665
RHOG MISSION shRNA shRNA Plasmid DNA
ras homolog family member G
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001665.2-192s1c1
Sequence:CCGGCTGCTACACAACTAACGCTTTCTCGAGAAAGCGTTAGTTGTGTAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001665.2-324s1c1
Sequence:CCGGCCGCCTCCGTACACTCTCCTACTCGAGTAGGAGAGTGTACGGAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001665.2-616s1c1
Sequence:CCGGGATGGTGTCAAGGAAGTGTTCCTCGAGGAACACTTCCTTGACACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001665.2-273s1c1
Sequence:CCGGGCGCACAGTGAACCTGAACCTCTCGAGAGGTTCAGGTTCACTGTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001665.2-395s1c1
Sequence:CCGGCCTATGAGAACGTGCGGCACACTCGAGTGTGCCGCACGTTCTCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001665
RHOG MISSION shRNA Lentiviral Transduction Particles
ras homolog family member G
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001665.2-192s1c1
Sequence:CCGGCTGCTACACAACTAACGCTTTCTCGAGAAAGCGTTAGTTGTGTAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001665.2-324s1c1
Sequence:CCGGCCGCCTCCGTACACTCTCCTACTCGAGTAGGAGAGTGTACGGAGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001665.2-616s1c1
Sequence:CCGGGATGGTGTCAAGGAAGTGTTCCTCGAGGAACACTTCCTTGACACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001665.2-273s1c1
Sequence:CCGGGCGCACAGTGAACCTGAACCTCTCGAGAGGTTCAGGTTCACTGTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001665.2-395s1c1
Sequence:CCGGCCTATGAGAACGTGCGGCACACTCGAGTGTGCCGCACGTTCTCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)