EMAIL THIS PAGE TO A FRIEND

RHOH

ras homolog family member H

88 Gene Product Result for
Synonyms: ARHH TTF
UniProtKB ID: Q15669
Gene ID:
Human(399) Summary: The protein encoded by this gene is a member of the Ras superfamily of guanosine triphosphate (GTP)-metabolizing enzymes. The encoded protein is expressed in hematopoietic cells, where it functions as a negative regulator of cell growth and survival. This gene may be hypermutated or misexpressed in leukemias and lymphomas. Chromosomal translocations in non-Hodgkin's lymphoma occur between this locus and B-cell CLL/lymphoma 6 (BCL6) on chromosome 3, leading to the production of fusion transcripts. Alternative splicing in the 5' untranslated region results in multiple transcript variants that encode the same protein. [provided by RefSeq, May 2013]
Mouse(74734) ras homolog gene family, member H
Rat(305341) ras homolog family member H
Zebrafish(553413) ras homolog gene family, member H
chicken(428786) ras homolog family member H
dog(488833) ras homolog family member H
domestic cat(101081466) ras homolog family member H
cow(768307) ras homolog gene family, member H
sheep(100147795) ras homolog family member H
naked mole-rat(101705393) ras homolog family member H
domestic guinea pig(100717196) ras homolog family member H
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004310 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004310 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004310 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_359315 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_359315 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_359315 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004310 Rosetta Predictions human pricing
NM_001013430 Rosetta Predictions rat pricing
NM_001081105 Rosetta Predictions mouse pricing
XM_132051 Rosetta Predictions mouse pricing
XM_893234 Rosetta Predictions mouse pricing
XM_900704 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337332 predicted 1555
2 SASI_Hs02_00337333 predicted 1734
3 SASI_Hs01_00205263 predicted 809
4 SASI_Hs01_00205264 predicted 1303
5 SASI_Hs01_00205265 predicted 1304
6 SASI_Hs02_00337334 predicted 1744
7 SASI_Hs02_00337335 predicted 1551
8 SASI_Hs02_00337336 predicted 1523
9 SASI_Hs01_00205270 predicted 1193
10 SASI_Hs02_00337337 predicted 1475
11 SASI_Hs01_00205261 predicted 1189
12 SASI_Hs01_00205262 predicted 933
13 SASI_Hs01_00205266 predicted 698
14 SASI_Hs01_00205267 predicted 1095
15 SASI_Hs01_00205268 predicted 1234
16 SASI_Hs01_00205269 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013430 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101233 predicted 655
2 SASI_Rn01_00101234 predicted 785
3 SASI_Rn01_00101235 predicted 1145
4 SASI_Rn01_00101236 predicted 1231
5 SASI_Rn01_00101237 predicted 832
6 SASI_Rn01_00101239 predicted 1161
7 SASI_Rn01_00101240 predicted 1175
8 SASI_Rn02_00201101 predicted 682
9 SASI_Rn01_00101242 predicted 1217
10 SASI_Rn02_00201102 predicted 803
11 SASI_Rn01_00101238 predicted 1008
12 SASI_Rn01_00101241 predicted 1100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081105 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295231 predicted 740
2 SASI_Mm02_00295232 predicted 1557
3 SASI_Mm02_00295233 predicted 1302
4 SASI_Mm02_00295234 predicted 1233
5 SASI_Mm02_00295235 predicted 1385
6 SASI_Mm02_00295236 predicted 1429
7 SASI_Mm02_00295237 predicted 1695
8 SASI_Mm02_00295238 predicted 1554
9 SASI_Mm02_00295239 predicted 1240
10 SASI_Mm02_00295240 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266783 predicted 738
2 SASI_Mm01_00266784 predicted 890
3 SASI_Mm01_00266785 predicted 1482
4 SASI_Mm01_00266786 predicted 1482
5 SASI_Mm01_00266787 predicted 937
6 SASI_Mm01_00266788 predicted 759
7 SASI_Mm01_00266789 predicted 832
8 SASI_Mm01_00266790 predicted 875
9 SASI_Mm01_00266791 predicted 778
10 SASI_Mm01_00266792 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_893234 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216519 predicted 876
2 SASI_Mm01_00216520 predicted 1017
3 SASI_Mm01_00216521 predicted 1612
4 SASI_Mm01_00216522 predicted 1613
5 SASI_Mm01_00216523 predicted 1073
6 SASI_Mm01_00216524 predicted 892
7 SASI_Mm01_00216525 predicted 960
8 SASI_Mm01_00216526 predicted 1014
9 SASI_Mm01_00216527 predicted 902
10 SASI_Mm01_00216528 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216788 predicted 483
2 SASI_Mm01_00216789 predicted 625
3 SASI_Mm01_00216790 predicted 1229
4 SASI_Mm01_00216791 predicted 1221
5 SASI_Mm01_00216792 predicted 676
6 SASI_Mm01_00216793 predicted 490
7 SASI_Mm01_00216794 predicted 571
8 SASI_Mm01_00216795 predicted 620
9 SASI_Mm01_00216796 predicted 517
10 SASI_Mm01_00216797 predicted 619
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004310
RHOH MISSION shRNA Bacterial Glycerol Stock
ras homolog family member H
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004310.3-825s21c1
Sequence:CCGGAGCCCACAGTGTACGAGAACACTCGAGTGTTCTCGTACACTGTGGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004310.3-1308s21c1
Sequence:CCGGGAGACTTCACACAACACTTATCTCGAGATAAGTGTTGTGTGAAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004310.3-1172s21c1
Sequence:CCGGGAGTGCTCAGCCCTTAGCAATCTCGAGATTGCTAAGGGCTGAGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004310.2-1195s1c1
Sequence:CCGGCTTCTCCATCAATGAGTGCAACTCGAGTTGCACTCATTGATGGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004310.2-828s1c1
Sequence:CCGGCCGGCAATGACGCCTTCAGAACTCGAGTTCTGAAGGCGTCATTGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004310.2-1177s1c1
Sequence:CCGGACGAAACAGAAGGAGGCTCTTCTCGAGAAGAGCCTCCTTCTGTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004310.2-936s1c1
Sequence:CCGGACAAGTGGATTGGTGAAATTACTCGAGTAATTTCACCAATCCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004310.2-910s1c1
Sequence:CCGGCCATAACTCATTCCTGAACTTCTCGAGAAGTTCAGGAATGAGTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004310
RHOH MISSION shRNA shRNA Plasmid DNA
ras homolog family member H
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004310.3-825s21c1
Sequence:CCGGAGCCCACAGTGTACGAGAACACTCGAGTGTTCTCGTACACTGTGGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004310.3-1308s21c1
Sequence:CCGGGAGACTTCACACAACACTTATCTCGAGATAAGTGTTGTGTGAAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004310.3-1172s21c1
Sequence:CCGGGAGTGCTCAGCCCTTAGCAATCTCGAGATTGCTAAGGGCTGAGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004310.2-1195s1c1
Sequence:CCGGCTTCTCCATCAATGAGTGCAACTCGAGTTGCACTCATTGATGGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004310.2-828s1c1
Sequence:CCGGCCGGCAATGACGCCTTCAGAACTCGAGTTCTGAAGGCGTCATTGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004310.2-1177s1c1
Sequence:CCGGACGAAACAGAAGGAGGCTCTTCTCGAGAAGAGCCTCCTTCTGTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004310.2-936s1c1
Sequence:CCGGACAAGTGGATTGGTGAAATTACTCGAGTAATTTCACCAATCCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004310.2-910s1c1
Sequence:CCGGCCATAACTCATTCCTGAACTTCTCGAGAAGTTCAGGAATGAGTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004310
RHOH MISSION shRNA Lentiviral Transduction Particles
ras homolog family member H
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004310.3-825s21c1
Sequence:CCGGAGCCCACAGTGTACGAGAACACTCGAGTGTTCTCGTACACTGTGGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004310.3-1308s21c1
Sequence:CCGGGAGACTTCACACAACACTTATCTCGAGATAAGTGTTGTGTGAAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004310.3-1172s21c1
Sequence:CCGGGAGTGCTCAGCCCTTAGCAATCTCGAGATTGCTAAGGGCTGAGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004310.2-1195s1c1
Sequence:CCGGCTTCTCCATCAATGAGTGCAACTCGAGTTGCACTCATTGATGGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004310.2-828s1c1
Sequence:CCGGCCGGCAATGACGCCTTCAGAACTCGAGTTCTGAAGGCGTCATTGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004310.2-1177s1c1
Sequence:CCGGACGAAACAGAAGGAGGCTCTTCTCGAGAAGAGCCTCCTTCTGTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004310.2-936s1c1
Sequence:CCGGACAAGTGGATTGGTGAAATTACTCGAGTAATTTCACCAATCCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004310.2-910s1c1
Sequence:CCGGCCATAACTCATTCCTGAACTTCTCGAGAAGTTCAGGAATGAGTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_359315
RHOH MISSION shRNA Bacterial Glycerol Stock
ras homolog family member H
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_359315.1-1225s1c1
Sequence:CCGGGCCCAACATTCATGAATGTATCTCGAGATACATTCATGAATGTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359315.1-1161s1c1
Sequence:CCGGGCGAAACAGAAGGAAGCTGTTCTCGAGAACAGCTTCCTTCTGTTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359315.1-890s1c1
Sequence:CCGGCCAACCATAACTCGTTCCTGACTCGAGTCAGGAACGAGTTATGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359315.1-1015s1c1
Sequence:CCGGGCTTCCTGCATCAATGCCATACTCGAGTATGGCATTGATGCAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359315.1-891s1c1
Sequence:CCGGCAACCATAACTCGTTCCTGAACTCGAGTTCAGGAACGAGTTATGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_359315
RHOH MISSION shRNA shRNA Plasmid DNA
ras homolog family member H
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_359315.1-1225s1c1
Sequence:CCGGGCCCAACATTCATGAATGTATCTCGAGATACATTCATGAATGTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359315.1-1161s1c1
Sequence:CCGGGCGAAACAGAAGGAAGCTGTTCTCGAGAACAGCTTCCTTCTGTTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359315.1-890s1c1
Sequence:CCGGCCAACCATAACTCGTTCCTGACTCGAGTCAGGAACGAGTTATGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359315.1-1015s1c1
Sequence:CCGGGCTTCCTGCATCAATGCCATACTCGAGTATGGCATTGATGCAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359315.1-891s1c1
Sequence:CCGGCAACCATAACTCGTTCCTGAACTCGAGTTCAGGAACGAGTTATGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_359315
RHOH MISSION shRNA Lentiviral Transduction Particles
ras homolog family member H
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_359315.1-1225s1c1
Sequence:CCGGGCCCAACATTCATGAATGTATCTCGAGATACATTCATGAATGTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359315.1-1161s1c1
Sequence:CCGGGCGAAACAGAAGGAAGCTGTTCTCGAGAACAGCTTCCTTCTGTTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359315.1-890s1c1
Sequence:CCGGCCAACCATAACTCGTTCCTGACTCGAGTCAGGAACGAGTTATGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359315.1-1015s1c1
Sequence:CCGGGCTTCCTGCATCAATGCCATACTCGAGTATGGCATTGATGCAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359315.1-891s1c1
Sequence:CCGGCAACCATAACTCGTTCCTGAACTCGAGTTCAGGAACGAGTTATGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)