EMAIL THIS PAGE TO A FRIEND

RHOJ

ras homolog family member J

59 Gene Product Result for
Synonyms: ARHJ RASL7B TC10B TCL
UniProtKB ID: Q9H4E5, Q96KC1
Gene ID:
Human(57381) Summary: This gene encodes one of the many small GTP-binding proteins in the Rho family shown to be associated with focal adhesions in endothelial cells (PMID: 21148427, 22103495). The encoded protein is activated by vascular endothelial growth factor and may regulate angiogenesis. [provided by RefSeq, Dec 2011]
Mouse(80837) ras homolog gene family, member J
Rat(299145) ras homolog family member J
domestic guinea pig(100724210) ras homolog family member J
naked mole-rat(101713021) ras homolog family member J
cow(540619) ras homolog gene family, member J
sheep(101107285) ras homolog family member J
Zebrafish(556371) ras homolog gene family, member J
domestic cat(101094604) ras homolog family member J
dog(612985) ras homolog family member J
chicken(423513) ras homolog gene family, member J
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020663 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023275 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023275 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023275 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129691 MISSION® esiRNA esiRNA human RHOJ (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020663 Rosetta Predictions human pricing
NM_001008320 Rosetta Predictions rat pricing
XM_001080778 Rosetta Predictions rat pricing
NM_023275 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074414 predicted 1392
2 SASI_Hs01_00074415 predicted 1487
3 SASI_Hs01_00074417 predicted 1520
4 SASI_Hs01_00074418 predicted 1543
5 SASI_Hs01_00074419 predicted 1586
6 SASI_Hs01_00074420 predicted 740
7 SASI_Hs01_00074421 predicted 603
8 SASI_Hs01_00074422 predicted 1530
9 SASI_Hs02_00353651 predicted 1131
10 SASI_Hs02_00353652 predicted 838
11 SASI_Hs01_00074413 predicted 1545
12 SASI_Hs01_00074416 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008320 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090384 predicted 364
2 SASI_Rn01_00090385 predicted 466
3 SASI_Rn01_00090387 predicted 403
4 SASI_Rn01_00090388 predicted 558
5 SASI_Rn01_00090389 predicted 572
6 SASI_Rn01_00090390 predicted 539
7 SASI_Rn01_00090391 predicted 422
8 SASI_Rn01_00090392 predicted 418
9 SASI_Rn01_00090393 predicted 491
10 SASI_Rn02_00199058 predicted 554
11 SASI_Rn01_00090386 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369322 predicted 607
2 SASI_Rn02_00369323 predicted 530
3 SASI_Rn02_00369324 predicted 534
4 SASI_Rn02_00369325 predicted 534
5 SASI_Rn02_00369326 predicted 685
6 SASI_Rn02_00369327 predicted 706
7 SASI_Rn02_00369328 predicted 721
8 SASI_Rn02_00369329 predicted 628
9 SASI_Rn02_00369330 predicted 776
10 SASI_Rn02_00369331 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096818 predicted 826
2 SASI_Mm01_00096819 predicted 660
3 SASI_Mm01_00096820 predicted 796
4 SASI_Mm01_00096821 predicted 808
5 SASI_Mm01_00096822 predicted 662
6 SASI_Mm01_00096823 predicted 869
7 SASI_Mm01_00096824 predicted 650
8 SASI_Mm01_00096827 predicted 726
9 SASI_Mm02_00327013 predicted 711
10 SASI_Mm02_00327014 predicted 879
11 SASI_Mm01_00096825 predicted 545
12 SASI_Mm01_00096826 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020663
RHOJ MISSION shRNA Bacterial Glycerol Stock
ras homolog family member J
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020663.3-1538s21c1
Sequence:CCGGCCATGTGTCTCACATTCATTTCTCGAGAAATGAATGTGAGACACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020663.2-878s1c1
Sequence:CCGGGCCCGTTTGCTGTATATGAAACTCGAGTTTCATATACAGCAAACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020663.2-647s1c1
Sequence:CCGGCAACACTTGCTCGGACTGTATCTCGAGATACAGTCCGAGCAAGTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020663.2-748s1c1
Sequence:CCGGTGTCGTAAACCCTGCCTCTTACTCGAGTAAGAGGCAGGGTTTACGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020663.2-598s1c1
Sequence:CCGGGCCCACTGTGTTTGACCACTACTCGAGTAGTGGTCAAACACAGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020663.2-1007s1c1
Sequence:CCGGGATGAAGCAATCCTCACCATTCTCGAGAATGGTGAGGATTGCTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020663.3-976s21c1
Sequence:CCGGTGACTCAGAAAGGTCTCAAAGCTCGAGCTTTGAGACCTTTCTGAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020663.3-1491s21c1
Sequence:CCGGACTTGGGACTACAATACTAACCTCGAGGTTAGTATTGTAGTCCCAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020663
RHOJ MISSION shRNA shRNA Plasmid DNA
ras homolog family member J
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020663.3-1538s21c1
Sequence:CCGGCCATGTGTCTCACATTCATTTCTCGAGAAATGAATGTGAGACACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020663.2-878s1c1
Sequence:CCGGGCCCGTTTGCTGTATATGAAACTCGAGTTTCATATACAGCAAACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020663.2-647s1c1
Sequence:CCGGCAACACTTGCTCGGACTGTATCTCGAGATACAGTCCGAGCAAGTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020663.2-748s1c1
Sequence:CCGGTGTCGTAAACCCTGCCTCTTACTCGAGTAAGAGGCAGGGTTTACGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020663.2-598s1c1
Sequence:CCGGGCCCACTGTGTTTGACCACTACTCGAGTAGTGGTCAAACACAGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020663.2-1007s1c1
Sequence:CCGGGATGAAGCAATCCTCACCATTCTCGAGAATGGTGAGGATTGCTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020663.3-976s21c1
Sequence:CCGGTGACTCAGAAAGGTCTCAAAGCTCGAGCTTTGAGACCTTTCTGAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020663.3-1491s21c1
Sequence:CCGGACTTGGGACTACAATACTAACCTCGAGGTTAGTATTGTAGTCCCAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020663
RHOJ MISSION shRNA Lentiviral Transduction Particles
ras homolog family member J
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020663.3-1538s21c1
Sequence:CCGGCCATGTGTCTCACATTCATTTCTCGAGAAATGAATGTGAGACACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020663.2-878s1c1
Sequence:CCGGGCCCGTTTGCTGTATATGAAACTCGAGTTTCATATACAGCAAACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020663.2-647s1c1
Sequence:CCGGCAACACTTGCTCGGACTGTATCTCGAGATACAGTCCGAGCAAGTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020663.2-748s1c1
Sequence:CCGGTGTCGTAAACCCTGCCTCTTACTCGAGTAAGAGGCAGGGTTTACGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020663.2-598s1c1
Sequence:CCGGGCCCACTGTGTTTGACCACTACTCGAGTAGTGGTCAAACACAGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020663.2-1007s1c1
Sequence:CCGGGATGAAGCAATCCTCACCATTCTCGAGAATGGTGAGGATTGCTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020663.3-976s21c1
Sequence:CCGGTGACTCAGAAAGGTCTCAAAGCTCGAGCTTTGAGACCTTTCTGAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020663.3-1491s21c1
Sequence:CCGGACTTGGGACTACAATACTAACCTCGAGGTTAGTATTGTAGTCCCAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023275
VALIDATED
RHOJ MISSION shRNA Bacterial Glycerol Stock
ras homolog family member J
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023275.2-713s21c1
Sequence:CCGGCAGCACTTGCTTGGACTATACCTCGAGGTATAGTCCAAGCAAGTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023275.1-702s1c1
Sequence:CCGGTGTCGTAAACCCAGCCTCTTACTCGAGTAAGAGGCTGGGTTTACGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023275.1-559s1c1
Sequence:CCGGGTGTTTGACCACTACGCAGTTCTCGAGAACTGCGTAGTGGTCAAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023275.1-690s1c1
Sequence:CCGGCATCTGCTTCTCTGTCGTAAACTCGAGTTTACGACAGAGAAGCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023275.2-802s21c1
Sequence:CCGGCATCTGCTTCTCTGTCGTAAACTCGAGTTTACGACAGAGAAGCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023275.2-814s21c1
Sequence:CCGGTGTCGTAAACCCAGCCTCTTACTCGAGTAAGAGGCTGGGTTTACGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023275.2-1591s21c1
Sequence:CCGGCAAGCACCTTAACGCTCATTTCTCGAGAAATGAGCGTTAAGGTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023275.2-673s21c1
Sequence:CCGGGTTTGACCACTACGCAGTTACCTCGAGGTAACTGCGTAGTGGTCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023275
VALIDATED
RHOJ MISSION shRNA shRNA Plasmid DNA
ras homolog family member J
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023275.2-713s21c1
Sequence:CCGGCAGCACTTGCTTGGACTATACCTCGAGGTATAGTCCAAGCAAGTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023275.1-702s1c1
Sequence:CCGGTGTCGTAAACCCAGCCTCTTACTCGAGTAAGAGGCTGGGTTTACGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023275.1-559s1c1
Sequence:CCGGGTGTTTGACCACTACGCAGTTCTCGAGAACTGCGTAGTGGTCAAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023275.1-690s1c1
Sequence:CCGGCATCTGCTTCTCTGTCGTAAACTCGAGTTTACGACAGAGAAGCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023275.2-802s21c1
Sequence:CCGGCATCTGCTTCTCTGTCGTAAACTCGAGTTTACGACAGAGAAGCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023275.2-814s21c1
Sequence:CCGGTGTCGTAAACCCAGCCTCTTACTCGAGTAAGAGGCTGGGTTTACGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023275.2-1591s21c1
Sequence:CCGGCAAGCACCTTAACGCTCATTTCTCGAGAAATGAGCGTTAAGGTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023275.2-673s21c1
Sequence:CCGGGTTTGACCACTACGCAGTTACCTCGAGGTAACTGCGTAGTGGTCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023275
VALIDATED
RHOJ MISSION shRNA Lentiviral Transduction Particles
ras homolog family member J
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023275.2-713s21c1
Sequence:CCGGCAGCACTTGCTTGGACTATACCTCGAGGTATAGTCCAAGCAAGTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023275.1-702s1c1
Sequence:CCGGTGTCGTAAACCCAGCCTCTTACTCGAGTAAGAGGCTGGGTTTACGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023275.1-559s1c1
Sequence:CCGGGTGTTTGACCACTACGCAGTTCTCGAGAACTGCGTAGTGGTCAAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023275.1-690s1c1
Sequence:CCGGCATCTGCTTCTCTGTCGTAAACTCGAGTTTACGACAGAGAAGCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023275.2-802s21c1
Sequence:CCGGCATCTGCTTCTCTGTCGTAAACTCGAGTTTACGACAGAGAAGCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023275.2-814s21c1
Sequence:CCGGTGTCGTAAACCCAGCCTCTTACTCGAGTAAGAGGCTGGGTTTACGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023275.2-1591s21c1
Sequence:CCGGCAAGCACCTTAACGCTCATTTCTCGAGAAATGAGCGTTAAGGTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023275.2-673s21c1
Sequence:CCGGGTTTGACCACTACGCAGTTACCTCGAGGTAACTGCGTAGTGGTCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)