EMAIL THIS PAGE TO A FRIEND

RHOQ

ras homolog family member Q

208 Gene Product Result for
Synonyms: ARHQ RASL7A TC10 TC10A
Gene ID:
Human(23433) Summary: This gene encodes a member of the Rho family of small GTPases, which cycle between inactive GDP-bound and active GTP-bound states and function as molecular switches in signal transduction cascades. Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. The encoded protein is an important signalling protein for sarcomere assembly and has been shown to play a significant role in the exocytosis of the solute carrier family 2, facilitated glucose transporter member 4 and other proteins, possibly acting as the signal that turns on the membrane fusion machinery. Three related pseudogene have been identified on chromosomes 2 and 14. [provided by RefSeq, Aug 2011]
Mouse(104215) ras homolog gene family, member Q
Rat(85428) ras homolog family member Q
Zebrafish(327510) ras homolog gene family, member Q
chicken(395114) ras homolog gene family, member Q
dog(474579) ras homolog family member Q
cow(100139988) ras homolog gene family, member Q
naked mole-rat(101702025) ras homolog family member Q
domestic guinea pig(100727783) ras homolog family member Q
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145491 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145491 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145491 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012249 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012249 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012249 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012249 Rosetta Predictions human pricing
NM_053522 Rosetta Predictions rat pricing
NM_145491 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343945 predicted 1125
2 SASI_Hs02_00343946 predicted 520
3 SASI_Hs02_00343947 predicted 482
4 SASI_Hs02_00343948 predicted 1124
5 SASI_Hs02_00343949 predicted 538
6 SASI_Hs02_00343950 predicted 479
7 SASI_Hs01_00104181 predicted 1421
8 SASI_Hs02_00343951 predicted 1121
9 SASI_Hs02_00343952 predicted 642
10 SASI_Hs02_00343953 predicted 1251
11 SASI_Hs01_00104182 predicted 1430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053522 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121876 predicted 904
2 SASI_Rn01_00121877 predicted 703
3 SASI_Rn01_00121878 predicted 1108
4 SASI_Rn01_00121879 predicted 920
5 SASI_Rn01_00121880 predicted 998
6 SASI_Rn01_00121881 predicted 565
7 SASI_Rn01_00121882 predicted 876
8 SASI_Rn01_00121883 predicted 875
9 SASI_Rn01_00121884 predicted 823
10 SASI_Rn01_00121885 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145491 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055373 predicted 1282
2 SASI_Mm01_00055374 predicted 1494
3 SASI_Mm01_00055375 predicted 1462
4 SASI_Mm01_00055376 predicted 1301
5 SASI_Mm01_00055377 predicted 693
6 SASI_Mm01_00055378 predicted 1476
7 SASI_Mm01_00055379 predicted 701
8 SASI_Mm01_00055381 predicted 1464
9 SASI_Mm01_00055382 predicted 1602
10 SASI_Mm02_00340927 predicted 1292
11 SASI_Mm01_00055380 predicted 749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145491
VALIDATED
RHOQ MISSION shRNA Bacterial Glycerol Stock
ras homolog family member Q
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145491.2-892s21c1
Sequence:CCGGGCAAGACTGAATGACATGAAACTCGAGTTTCATGTCATTCAGTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145491.2-661s21c1
Sequence:CCGGCAGTACCTCTTGGGACTCTATCTCGAGATAGAGTCCCAAGAGGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145491.2-813s21c1
Sequence:CCGGGCTAAAGGAATATGCGCCAAACTCGAGTTTGGCGCATATTCCTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145491.2-1732s21c1
Sequence:CCGGGCCAAGTTGAATAGATCATAACTCGAGTTATGATCTATTCAACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145491.2-1014s21c1
Sequence:CCGGTGTGTTTGATGAGGCTATCATCTCGAGATGATAGCCTCATCAAACACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145491.2-661s1c1
Sequence:CCGGCAGTACCTCTTGGGACTCTATCTCGAGATAGAGTCCCAAGAGGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145491.2-1014s1c1
Sequence:CCGGTGTGTTTGATGAGGCTATCATCTCGAGATGATAGCCTCATCAAACACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145491.2-892s1c1
Sequence:CCGGGCAAGACTGAATGACATGAAACTCGAGTTTCATGTCATTCAGTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145491.2-1732s1c1
Sequence:CCGGGCCAAGTTGAATAGATCATAACTCGAGTTATGATCTATTCAACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145491.2-813s1c1
Sequence:CCGGGCTAAAGGAATATGCGCCAAACTCGAGTTTGGCGCATATTCCTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145491
VALIDATED
RHOQ MISSION shRNA shRNA Plasmid DNA
ras homolog family member Q
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145491.2-892s21c1
Sequence:CCGGGCAAGACTGAATGACATGAAACTCGAGTTTCATGTCATTCAGTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145491.2-661s21c1
Sequence:CCGGCAGTACCTCTTGGGACTCTATCTCGAGATAGAGTCCCAAGAGGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145491.2-813s21c1
Sequence:CCGGGCTAAAGGAATATGCGCCAAACTCGAGTTTGGCGCATATTCCTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145491.2-1732s21c1
Sequence:CCGGGCCAAGTTGAATAGATCATAACTCGAGTTATGATCTATTCAACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145491.2-1014s21c1
Sequence:CCGGTGTGTTTGATGAGGCTATCATCTCGAGATGATAGCCTCATCAAACACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145491.2-661s1c1
Sequence:CCGGCAGTACCTCTTGGGACTCTATCTCGAGATAGAGTCCCAAGAGGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145491.2-1014s1c1
Sequence:CCGGTGTGTTTGATGAGGCTATCATCTCGAGATGATAGCCTCATCAAACACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145491.2-892s1c1
Sequence:CCGGGCAAGACTGAATGACATGAAACTCGAGTTTCATGTCATTCAGTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145491.2-1732s1c1
Sequence:CCGGGCCAAGTTGAATAGATCATAACTCGAGTTATGATCTATTCAACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145491.2-813s1c1
Sequence:CCGGGCTAAAGGAATATGCGCCAAACTCGAGTTTGGCGCATATTCCTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145491
VALIDATED
RHOQ MISSION shRNA Lentiviral Transduction Particles
ras homolog family member Q
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145491.2-892s21c1
Sequence:CCGGGCAAGACTGAATGACATGAAACTCGAGTTTCATGTCATTCAGTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145491.2-661s21c1
Sequence:CCGGCAGTACCTCTTGGGACTCTATCTCGAGATAGAGTCCCAAGAGGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145491.2-813s21c1
Sequence:CCGGGCTAAAGGAATATGCGCCAAACTCGAGTTTGGCGCATATTCCTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145491.2-1732s21c1
Sequence:CCGGGCCAAGTTGAATAGATCATAACTCGAGTTATGATCTATTCAACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145491.2-1014s21c1
Sequence:CCGGTGTGTTTGATGAGGCTATCATCTCGAGATGATAGCCTCATCAAACACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145491.2-661s1c1
Sequence:CCGGCAGTACCTCTTGGGACTCTATCTCGAGATAGAGTCCCAAGAGGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145491.2-1014s1c1
Sequence:CCGGTGTGTTTGATGAGGCTATCATCTCGAGATGATAGCCTCATCAAACACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145491.2-892s1c1
Sequence:CCGGGCAAGACTGAATGACATGAAACTCGAGTTTCATGTCATTCAGTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145491.2-1732s1c1
Sequence:CCGGGCCAAGTTGAATAGATCATAACTCGAGTTATGATCTATTCAACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145491.2-813s1c1
Sequence:CCGGGCTAAAGGAATATGCGCCAAACTCGAGTTTGGCGCATATTCCTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012249
VALIDATED
RHOQ MISSION shRNA Bacterial Glycerol Stock
ras homolog family member Q
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012249.3-716s21c1
Sequence:CCGGGCAAGACTGAATGATATGAAACTCGAGTTTCATATCATTCAGTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012249.3-680s21c1
Sequence:CCGGACTCAGATTGATCTCCGAGATCTCGAGATCTCGGAGATCAATCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012249.3-538s21c1
Sequence:CCGGGAGGCCTTTATCTTACCCAATCTCGAGATTGGGTAAGATAAAGGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308154    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012249.3-1126s21c1
Sequence:CCGGTCTGAAGCCACAATCTATTATCTCGAGATAATAGATTGTGGCTTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012249.1-96s1c1
Sequence:CCGGCCTACTCATGAGCTATGCCAACTCGAGTTGGCATAGCTCATGAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012249.1-385s1c1
Sequence:CCGGACTCAGATTGATCTCCGAGATCTCGAGATCTCGGAGATCAATCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012249.1-421s1c1
Sequence:CCGGGCAAGACTGAATGATATGAAACTCGAGTTTCATATCATTCAGTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012249.1-243s1c1
Sequence:CCGGGAGGCCTTTATCTTACCCAATCTCGAGATTGGGTAAGATAAAGGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012249.1-290s1c1
Sequence:CCGGCGGTGGTAAATCCAGCCTCATCTCGAGATGAGGCTGGATTTACCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012249
VALIDATED
RHOQ MISSION shRNA shRNA Plasmid DNA
ras homolog family member Q
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012249.3-716s21c1
Sequence:CCGGGCAAGACTGAATGATATGAAACTCGAGTTTCATATCATTCAGTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012249.3-680s21c1
Sequence:CCGGACTCAGATTGATCTCCGAGATCTCGAGATCTCGGAGATCAATCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012249.3-538s21c1
Sequence:CCGGGAGGCCTTTATCTTACCCAATCTCGAGATTGGGTAAGATAAAGGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308154    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012249.3-1126s21c1
Sequence:CCGGTCTGAAGCCACAATCTATTATCTCGAGATAATAGATTGTGGCTTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012249.1-96s1c1
Sequence:CCGGCCTACTCATGAGCTATGCCAACTCGAGTTGGCATAGCTCATGAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012249.1-385s1c1
Sequence:CCGGACTCAGATTGATCTCCGAGATCTCGAGATCTCGGAGATCAATCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012249.1-421s1c1
Sequence:CCGGGCAAGACTGAATGATATGAAACTCGAGTTTCATATCATTCAGTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012249.1-243s1c1
Sequence:CCGGGAGGCCTTTATCTTACCCAATCTCGAGATTGGGTAAGATAAAGGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012249.1-290s1c1
Sequence:CCGGCGGTGGTAAATCCAGCCTCATCTCGAGATGAGGCTGGATTTACCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012249
VALIDATED
RHOQ MISSION shRNA Lentiviral Transduction Particles
ras homolog family member Q
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012249.3-716s21c1
Sequence:CCGGGCAAGACTGAATGATATGAAACTCGAGTTTCATATCATTCAGTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012249.3-680s21c1
Sequence:CCGGACTCAGATTGATCTCCGAGATCTCGAGATCTCGGAGATCAATCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012249.3-538s21c1
Sequence:CCGGGAGGCCTTTATCTTACCCAATCTCGAGATTGGGTAAGATAAAGGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308154    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012249.3-1126s21c1
Sequence:CCGGTCTGAAGCCACAATCTATTATCTCGAGATAATAGATTGTGGCTTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012249.1-96s1c1
Sequence:CCGGCCTACTCATGAGCTATGCCAACTCGAGTTGGCATAGCTCATGAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012249.1-385s1c1
Sequence:CCGGACTCAGATTGATCTCCGAGATCTCGAGATCTCGGAGATCAATCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012249.1-421s1c1
Sequence:CCGGGCAAGACTGAATGATATGAAACTCGAGTTTCATATCATTCAGTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012249.1-243s1c1
Sequence:CCGGGAGGCCTTTATCTTACCCAATCTCGAGATTGGGTAAGATAAAGGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012249.1-290s1c1
Sequence:CCGGCGGTGGTAAATCCAGCCTCATCTCGAGATGAGGCTGGATTTACCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)