EMAIL THIS PAGE TO A FRIEND

RHOU

ras homolog family member U

65 Gene Product Result for
Synonyms: ARHU CDC42L1 DJ646B12.2 WRCH1 fJ646B12.2 hG28K
UniProtKB ID: Q7L0Q8, B1AKN1, Q59FE9, Q8TDQ2
Gene ID:
Human(58480) Summary: This gene encodes a member of the Rho family of GTPases. This protein can activate PAK1 and JNK1, and can induce filopodium formation and stress fiber dissolution. It may also mediate the effects of WNT1 signaling in the regulation of cell morphology, cytoskeletal organization, and cell proliferation. A non-coding transcript variant of this gene results from naturally occurring read-through transcription between this locus and the neighboring DUSP5P (dual specificity phosphatase 5 pseudogene) locus.[provided by RefSeq, Mar 2011]
Mouse(69581) ras homolog gene family, member U
cow(781044) ras homolog gene family, member U
chicken(428589) ras homolog family member U
domestic cat(101095684) ras homolog family member U
dog(479211) ras homolog family member U
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021205 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021205 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021205 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133955 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133955 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133955 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU015341 MISSION® esiRNA esiRNA targeting mouse Rhou (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021205 Rosetta Predictions human pricing
NM_133955 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090287 predicted 1272
2 SASI_Hs01_00090288 predicted 1437
3 SASI_Hs01_00090289 predicted 1222
4 SASI_Hs01_00090291 predicted 1645
5 SASI_Hs01_00090292 predicted 1580
6 SASI_Hs01_00090294 predicted 1213
7 SASI_Hs01_00090295 predicted 1651
8 SASI_Hs02_00354797 predicted 1445
9 SASI_Hs01_00090296 predicted 1178
10 SASI_Hs02_00354798 predicted 1114
11 SASI_Hs01_00090290 predicted 1382
12 SASI_Hs01_00090293 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133955 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071901 predicted 528
2 SASI_Mm01_00071902 predicted 743
3 SASI_Mm01_00071903 predicted 1163
4 SASI_Mm01_00071905 predicted 1062
5 SASI_Mm01_00071906 predicted 1009
6 SASI_Mm01_00071907 predicted 799
7 SASI_Mm01_00071908 predicted 219
8 SASI_Mm01_00071909 predicted 908
9 SASI_Mm01_00071910 predicted 1164
10 SASI_Mm02_00339066 predicted 907
11 SASI_Mm01_00071904 predicted 342
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021205
RHOU MISSION shRNA Bacterial Glycerol Stock
ras homolog family member U
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021205.4-1185s21c1
Sequence:CCGGTAAGCTGTGCGCCGAGGAAATCTCGAGATTTCCTCGGCGCACAGCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021205.4-1275s21c1
Sequence:CCGGCATCGTCGCTGGCATTCAATACTCGAGTATTGAATGCCAGCGACGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021205.4-1474s21c1
Sequence:CCGGTTTACTGCGTAGAACCTATATCTCGAGATATAGGTTCTACGCAGTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021205.4-936s1c1
Sequence:CCGGCGGACAGGATGAATTTGACAACTCGAGTTGTCAAATTCATCCTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021205.4-1105s1c1
Sequence:CCGGCAGTCGGATCTCAGAGAAGATCTCGAGATCTTCTCTGAGATCCGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021205.4-1308s1c1
Sequence:CCGGGCAACAGCCAAAGAAGTCTAACTCGAGTTAGACTTCTTTGGCTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021205.4-1218s1c1
Sequence:CCGGCTACATCGAGTGTTCAGCCTTCTCGAGAAGGCTGAACACTCGATGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021205.4-972s1c1
Sequence:CCGGCTACACCAACACAGACATCTTCTCGAGAAGATGTCTGTGTTGGTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021205
RHOU MISSION shRNA shRNA Plasmid DNA
ras homolog family member U
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021205.4-1185s21c1
Sequence:CCGGTAAGCTGTGCGCCGAGGAAATCTCGAGATTTCCTCGGCGCACAGCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021205.4-1275s21c1
Sequence:CCGGCATCGTCGCTGGCATTCAATACTCGAGTATTGAATGCCAGCGACGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021205.4-1474s21c1
Sequence:CCGGTTTACTGCGTAGAACCTATATCTCGAGATATAGGTTCTACGCAGTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021205.4-936s1c1
Sequence:CCGGCGGACAGGATGAATTTGACAACTCGAGTTGTCAAATTCATCCTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021205.4-1105s1c1
Sequence:CCGGCAGTCGGATCTCAGAGAAGATCTCGAGATCTTCTCTGAGATCCGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021205.4-1308s1c1
Sequence:CCGGGCAACAGCCAAAGAAGTCTAACTCGAGTTAGACTTCTTTGGCTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021205.4-1218s1c1
Sequence:CCGGCTACATCGAGTGTTCAGCCTTCTCGAGAAGGCTGAACACTCGATGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021205.4-972s1c1
Sequence:CCGGCTACACCAACACAGACATCTTCTCGAGAAGATGTCTGTGTTGGTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021205
RHOU MISSION shRNA Lentiviral Transduction Particles
ras homolog family member U
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021205.4-1185s21c1
Sequence:CCGGTAAGCTGTGCGCCGAGGAAATCTCGAGATTTCCTCGGCGCACAGCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021205.4-1275s21c1
Sequence:CCGGCATCGTCGCTGGCATTCAATACTCGAGTATTGAATGCCAGCGACGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021205.4-1474s21c1
Sequence:CCGGTTTACTGCGTAGAACCTATATCTCGAGATATAGGTTCTACGCAGTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021205.4-936s1c1
Sequence:CCGGCGGACAGGATGAATTTGACAACTCGAGTTGTCAAATTCATCCTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021205.4-1105s1c1
Sequence:CCGGCAGTCGGATCTCAGAGAAGATCTCGAGATCTTCTCTGAGATCCGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021205.4-1308s1c1
Sequence:CCGGGCAACAGCCAAAGAAGTCTAACTCGAGTTAGACTTCTTTGGCTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021205.4-1218s1c1
Sequence:CCGGCTACATCGAGTGTTCAGCCTTCTCGAGAAGGCTGAACACTCGATGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021205.4-972s1c1
Sequence:CCGGCTACACCAACACAGACATCTTCTCGAGAAGATGTCTGTGTTGGTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133955
VALIDATED
RHOU MISSION shRNA Bacterial Glycerol Stock
ras homolog family member U
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133955.4-1397s21c1
Sequence:CCGGCGTGACCAGTTATATTGCTATCTCGAGATAGCAATATAACTGGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133955.4-374s21c1
Sequence:CCGGCTGCTACACCAACACAGACATCTCGAGATGTCTGTGTTGGTGTAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133955.4-713s21c1
Sequence:CCGGGCTACAGCCAAAGAAGTCTAACTCGAGTTAGACTTCTTTGGCTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133955.4-528s21c1
Sequence:CCGGGACGTCAAAGTGCTCATAGAACTCGAGTTCTATGAGCACTTTGACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133955.4-448s21c1
Sequence:CCGGAGAAGTGGGTTCCAGAGATTCCTCGAGGAATCTCTGGAACCCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133955.1-1396s1c1
Sequence:CCGGCGTGACCAGTTATATTGCTATCTCGAGATAGCAATATAACTGGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133955.1-374s1c1
Sequence:CCGGCTGCTACACCAACACAGACATCTCGAGATGTCTGTGTTGGTGTAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133955.1-713s1c1
Sequence:CCGGGCTACAGCCAAAGAAGTCTAACTCGAGTTAGACTTCTTTGGCTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133955.1-254s1c1
Sequence:CCGGCGAGTACATCCCTACGGCCTTCTCGAGAAGGCCGTAGGGATGTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133955.1-528s1c1
Sequence:CCGGGACGTCAAAGTGCTCATAGAACTCGAGTTCTATGAGCACTTTGACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133955
VALIDATED
RHOU MISSION shRNA shRNA Plasmid DNA
ras homolog family member U
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133955.4-1397s21c1
Sequence:CCGGCGTGACCAGTTATATTGCTATCTCGAGATAGCAATATAACTGGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133955.4-374s21c1
Sequence:CCGGCTGCTACACCAACACAGACATCTCGAGATGTCTGTGTTGGTGTAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133955.4-713s21c1
Sequence:CCGGGCTACAGCCAAAGAAGTCTAACTCGAGTTAGACTTCTTTGGCTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133955.4-528s21c1
Sequence:CCGGGACGTCAAAGTGCTCATAGAACTCGAGTTCTATGAGCACTTTGACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133955.4-448s21c1
Sequence:CCGGAGAAGTGGGTTCCAGAGATTCCTCGAGGAATCTCTGGAACCCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133955.1-1396s1c1
Sequence:CCGGCGTGACCAGTTATATTGCTATCTCGAGATAGCAATATAACTGGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133955.1-374s1c1
Sequence:CCGGCTGCTACACCAACACAGACATCTCGAGATGTCTGTGTTGGTGTAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133955.1-713s1c1
Sequence:CCGGGCTACAGCCAAAGAAGTCTAACTCGAGTTAGACTTCTTTGGCTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133955.1-254s1c1
Sequence:CCGGCGAGTACATCCCTACGGCCTTCTCGAGAAGGCCGTAGGGATGTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133955.1-528s1c1
Sequence:CCGGGACGTCAAAGTGCTCATAGAACTCGAGTTCTATGAGCACTTTGACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133955
VALIDATED
RHOU MISSION shRNA Lentiviral Transduction Particles
ras homolog family member U
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133955.4-1397s21c1
Sequence:CCGGCGTGACCAGTTATATTGCTATCTCGAGATAGCAATATAACTGGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133955.4-374s21c1
Sequence:CCGGCTGCTACACCAACACAGACATCTCGAGATGTCTGTGTTGGTGTAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133955.4-713s21c1
Sequence:CCGGGCTACAGCCAAAGAAGTCTAACTCGAGTTAGACTTCTTTGGCTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133955.4-528s21c1
Sequence:CCGGGACGTCAAAGTGCTCATAGAACTCGAGTTCTATGAGCACTTTGACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133955.4-448s21c1
Sequence:CCGGAGAAGTGGGTTCCAGAGATTCCTCGAGGAATCTCTGGAACCCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077503    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133955.1-1396s1c1
Sequence:CCGGCGTGACCAGTTATATTGCTATCTCGAGATAGCAATATAACTGGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133955.1-374s1c1
Sequence:CCGGCTGCTACACCAACACAGACATCTCGAGATGTCTGTGTTGGTGTAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133955.1-713s1c1
Sequence:CCGGGCTACAGCCAAAGAAGTCTAACTCGAGTTAGACTTCTTTGGCTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133955.1-254s1c1
Sequence:CCGGCGAGTACATCCCTACGGCCTTCTCGAGAAGGCCGTAGGGATGTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133955.1-528s1c1
Sequence:CCGGGACGTCAAAGTGCTCATAGAACTCGAGTTCTATGAGCACTTTGACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)