EMAIL THIS PAGE TO A FRIEND

RHOXF2

Rhox homeobox family, member 2

24 Gene Product Result for
Synonyms: CT107 PEPP-2 PEPP2 THG1
UniProtKB ID: Q9BQY4, Q9BR00
Gene ID:
cow(101902430) Rhox homeobox family, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032498 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032498 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032498 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106181 MISSION® esiRNA esiRNA human RHOXF2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032498 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165686 predicted 837
2 SASI_Hs01_00165687 predicted 851
3 SASI_Hs01_00165689 predicted 1057
4 SASI_Hs01_00165691 predicted 755
5 SASI_Hs01_00165692 predicted 201
6 SASI_Hs01_00165693 predicted 719
7 SASI_Hs01_00165694 predicted 758
8 SASI_Hs02_00359977 predicted 198
9 SASI_Hs02_00359978 predicted 899
10 SASI_Hs02_00359979 predicted 955
11 SASI_Hs01_00165688 predicted 702
12 SASI_Hs01_00165690 predicted 757
13 SASI_Hs01_00165695 predicted 700
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032498
RHOXF2 MISSION shRNA Bacterial Glycerol Stock
Rhox homeobox family, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032498.1-1019s21c1
Sequence:CCGGTTTGTTATCGTGCCTTCTTTCCTCGAGGAAAGAAGGCACGATAACAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032498.1-828s21c1
Sequence:CCGGTAACCGCAGCTGAGGCCATAACTCGAGTTATGGCCTCAGCTGCGGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032498.1-736s21c1
Sequence:CCGGTGAGAATAGAAGAGCCAAATGCTCGAGCATTTGGCTCTTCTATTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032498.1-1090s21c1
Sequence:CCGGGTCTTTGAGCCAGATTCATATCTCGAGATATGAATCTGGCTCAAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032498.1-902s21c1
Sequence:CCGGCATTCCAGCAGCCTGTGTTTCCTCGAGGAAACACAGGCTGCTGGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032498.1-289s1c1
Sequence:CCGGGTCGCTTACTGAAGAGGTCAACTCGAGTTGACCTCTTCAGTAAGCGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032498.1-868s1c1
Sequence:CCGGCGGGATGAGAGATGATTACTTCTCGAGAAGTAATCATCTCTCATCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032498.1-695s1c1
Sequence:CCGGAGAAGCATGAATGTGACTGAACTCGAGTTCAGTCACATTCATGCTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032498.1-769s1c1
Sequence:CCGGGAGGGCATTAATGGCAAGAAACTCGAGTTTCTTGCCATTAATGCCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032498
RHOXF2 MISSION shRNA shRNA Plasmid DNA
Rhox homeobox family, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032498.1-1019s21c1
Sequence:CCGGTTTGTTATCGTGCCTTCTTTCCTCGAGGAAAGAAGGCACGATAACAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032498.1-828s21c1
Sequence:CCGGTAACCGCAGCTGAGGCCATAACTCGAGTTATGGCCTCAGCTGCGGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032498.1-736s21c1
Sequence:CCGGTGAGAATAGAAGAGCCAAATGCTCGAGCATTTGGCTCTTCTATTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032498.1-1090s21c1
Sequence:CCGGGTCTTTGAGCCAGATTCATATCTCGAGATATGAATCTGGCTCAAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032498.1-902s21c1
Sequence:CCGGCATTCCAGCAGCCTGTGTTTCCTCGAGGAAACACAGGCTGCTGGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032498.1-289s1c1
Sequence:CCGGGTCGCTTACTGAAGAGGTCAACTCGAGTTGACCTCTTCAGTAAGCGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032498.1-868s1c1
Sequence:CCGGCGGGATGAGAGATGATTACTTCTCGAGAAGTAATCATCTCTCATCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032498.1-695s1c1
Sequence:CCGGAGAAGCATGAATGTGACTGAACTCGAGTTCAGTCACATTCATGCTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032498.1-769s1c1
Sequence:CCGGGAGGGCATTAATGGCAAGAAACTCGAGTTTCTTGCCATTAATGCCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032498
RHOXF2 MISSION shRNA Lentiviral Transduction Particles
Rhox homeobox family, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032498.1-1019s21c1
Sequence:CCGGTTTGTTATCGTGCCTTCTTTCCTCGAGGAAAGAAGGCACGATAACAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032498.1-828s21c1
Sequence:CCGGTAACCGCAGCTGAGGCCATAACTCGAGTTATGGCCTCAGCTGCGGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032498.1-736s21c1
Sequence:CCGGTGAGAATAGAAGAGCCAAATGCTCGAGCATTTGGCTCTTCTATTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032498.1-1090s21c1
Sequence:CCGGGTCTTTGAGCCAGATTCATATCTCGAGATATGAATCTGGCTCAAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032498.1-902s21c1
Sequence:CCGGCATTCCAGCAGCCTGTGTTTCCTCGAGGAAACACAGGCTGCTGGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032498.1-289s1c1
Sequence:CCGGGTCGCTTACTGAAGAGGTCAACTCGAGTTGACCTCTTCAGTAAGCGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032498.1-868s1c1
Sequence:CCGGCGGGATGAGAGATGATTACTTCTCGAGAAGTAATCATCTCTCATCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032498.1-695s1c1
Sequence:CCGGAGAAGCATGAATGTGACTGAACTCGAGTTCAGTCACATTCATGCTTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032498.1-769s1c1
Sequence:CCGGGAGGGCATTAATGGCAAGAAACTCGAGTTTCTTGCCATTAATGCCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)