EMAIL THIS PAGE TO A FRIEND

RHPN1-AS1

RHPN1 antisense RNA 1 (head to head)

42 Gene Product Result for
Synonyms: C8orf51
Species: Human RHPN1-AS1(78998)
UniProtKB ID: Q9BWJ2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024035 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024035 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024035 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024035 Rosetta Predictions human pricing
XR_042123 Rosetta Predictions human pricing
XR_042124 Rosetta Predictions human pricing
XR_042125 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179895 predicted 437
2 SASI_Hs01_00179896 predicted 280
3 SASI_Hs01_00179897 predicted 791
4 SASI_Hs01_00179898 predicted 401
5 SASI_Hs01_00179899 predicted 364
6 SASI_Hs01_00179900 predicted 570
7 SASI_Hs01_00179901 predicted 416
8 SASI_Hs01_00179902 predicted 764
9 SASI_Hs01_00179903 predicted 407
10 SASI_Hs01_00179904 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533269 predicted 518
2 SASI_Hs02_00533270 predicted 348
3 SASI_Hs02_00533271 predicted 863
4 SASI_Hs02_00533272 predicted 274
5 SASI_Hs02_00533273 predicted 470
6 SASI_Hs02_00533274 predicted 437
7 SASI_Hs02_00533275 predicted 645
8 SASI_Hs02_00533276 predicted 251
9 SASI_Hs02_00533277 predicted 493
10 SASI_Hs02_00533278 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533279 predicted 513
2 SASI_Hs02_00533280 predicted 351
3 SASI_Hs02_00533281 predicted 866
4 SASI_Hs02_00533282 predicted 278
5 SASI_Hs02_00533283 predicted 468
6 SASI_Hs02_00533284 predicted 440
7 SASI_Hs02_00533285 predicted 652
8 SASI_Hs02_00533286 predicted 248
9 SASI_Hs02_00533287 predicted 492
10 SASI_Hs02_00533288 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533289 predicted 515
2 SASI_Hs02_00533290 predicted 356
3 SASI_Hs02_00533291 predicted 862
4 SASI_Hs02_00533292 predicted 274
5 SASI_Hs02_00533293 predicted 471
6 SASI_Hs02_00533294 predicted 438
7 SASI_Hs02_00533295 predicted 652
8 SASI_Hs02_00533296 predicted 248
9 SASI_Hs02_00533297 predicted 491
10 SASI_Hs02_00533298 predicted 554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024035
RHPN1-AS1 MISSION shRNA Bacterial Glycerol Stock
RHPN1 antisense RNA 1 (head to head)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172885    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024035.1-705s1c1
Sequence:CCGGGCTCAGAACACACCCTTTGAACTCGAGTTCAAAGGGTGTGTTCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172511    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024035.1-1664s1c1
Sequence:CCGGCCAAACCCTCTTAGCAGTCTTCTCGAGAAGACTGCTAAGAGGGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168659    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024035.1-1733s1c1
Sequence:CCGGGCAAGCATGTGTGACTGAAATCTCGAGATTTCAGTCACACATGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024035.1-361s1c1
Sequence:CCGGGTACAGAACCCACATCCTTCTCTCGAGAGAAGGATGTGGGTTCTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172660    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024035.1-1257s1c1
Sequence:CCGGGTCTCAAACTTCTGGGCTCAACTCGAGTTGAGCCCAGAAGTTTGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167209    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024035.1-1738s1c1
Sequence:CCGGCATGTGTGACTGAAATGGTATCTCGAGATACCATTTCAGTCACACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024035
RHPN1-AS1 MISSION shRNA shRNA Plasmid DNA
RHPN1 antisense RNA 1 (head to head)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172885    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024035.1-705s1c1
Sequence:CCGGGCTCAGAACACACCCTTTGAACTCGAGTTCAAAGGGTGTGTTCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172511    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024035.1-1664s1c1
Sequence:CCGGCCAAACCCTCTTAGCAGTCTTCTCGAGAAGACTGCTAAGAGGGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168659    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024035.1-1733s1c1
Sequence:CCGGGCAAGCATGTGTGACTGAAATCTCGAGATTTCAGTCACACATGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024035.1-361s1c1
Sequence:CCGGGTACAGAACCCACATCCTTCTCTCGAGAGAAGGATGTGGGTTCTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172660    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024035.1-1257s1c1
Sequence:CCGGGTCTCAAACTTCTGGGCTCAACTCGAGTTGAGCCCAGAAGTTTGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167209    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024035.1-1738s1c1
Sequence:CCGGCATGTGTGACTGAAATGGTATCTCGAGATACCATTTCAGTCACACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024035
RHPN1-AS1 MISSION shRNA Lentiviral Transduction Particles
RHPN1 antisense RNA 1 (head to head)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172885    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024035.1-705s1c1
Sequence:CCGGGCTCAGAACACACCCTTTGAACTCGAGTTCAAAGGGTGTGTTCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172511    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024035.1-1664s1c1
Sequence:CCGGCCAAACCCTCTTAGCAGTCTTCTCGAGAAGACTGCTAAGAGGGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168659    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024035.1-1733s1c1
Sequence:CCGGGCAAGCATGTGTGACTGAAATCTCGAGATTTCAGTCACACATGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024035.1-361s1c1
Sequence:CCGGGTACAGAACCCACATCCTTCTCTCGAGAGAAGGATGTGGGTTCTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172660    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024035.1-1257s1c1
Sequence:CCGGGTCTCAAACTTCTGGGCTCAACTCGAGTTGAGCCCAGAAGTTTGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167209    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024035.1-1738s1c1
Sequence:CCGGCATGTGTGACTGAAATGGTATCTCGAGATACCATTTCAGTCACACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)