EMAIL THIS PAGE TO A FRIEND

RHPN2

rhophilin, Rho GTPase binding protein 2

72 Gene Product Result for
Synonyms: P76RBE RHOBP
UniProtKB ID: Q8IUC4, Q8N3T7, Q8N9D6, Q8NE33, Q96RU1
Gene ID:
Human(85415) Summary: This gene encodes a member of the rhophilin family of Ras-homologous (Rho)-GTPase binding proteins. The encoded protein binds both GTP- and GDP-bound RhoA and GTP-bound RhoB and may be involved in the organization of the actin cytoskeleton. [provided by RefSeq, Apr 2009]
Mouse(52428) rhophilin, Rho GTPase binding protein 2
Rat(308516) rhophilin, Rho GTPase binding protein 2
Zebrafish(321330) rhophilin, Rho GTPase binding protein 2
chicken(415771) rhophilin, Rho GTPase binding protein 2
domestic cat(101091576) rhophilin, Rho GTPase binding protein 2
dog(403518) rhophilin, Rho GTPase binding protein 2
naked mole-rat(101722256) rhophilin, Rho GTPase binding protein 2
Domestic Rabbit(100357570) rhophilin, Rho GTPase binding protein 2
domestic guinea pig(100723999) rhophilin, Rho GTPase binding protein 2
cow(533687) rhophilin, Rho GTPase binding protein 2
sheep(101117270) rhophilin, Rho GTPase binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027897 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027897 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027897 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033103 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033103 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033103 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033103 Rosetta Predictions human pricing
NM_001107505 Rosetta Predictions rat pricing
NM_027897 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240132 predicted 2153
2 SASI_Hs01_00240133 predicted 810
3 SASI_Hs01_00240134 predicted 571
4 SASI_Hs01_00240136 predicted 216
5 SASI_Hs01_00240137 predicted 2079
6 SASI_Hs01_00240139 predicted 403
7 SASI_Hs01_00240140 predicted 1816
8 SASI_Hs01_00240135 predicted 2065
9 SASI_Hs01_00240141 predicted 1882
10 SASI_Hs02_00360808 predicted 1895
11 SASI_Hs01_00240138 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229485 predicted 604
2 SASI_Rn02_00229486 predicted 558
3 SASI_Rn02_00229487 predicted 708
4 SASI_Rn02_00229488 predicted 1573
5 SASI_Rn02_00229489 predicted 1221
6 SASI_Rn02_00229490 predicted 1316
7 SASI_Rn02_00229491 predicted 1736
8 SASI_Rn02_00229492 predicted 354
9 SASI_Rn02_00229493 predicted 1870
10 SASI_Rn02_00229494 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124039 predicted 1681
2 SASI_Mm01_00124040 predicted 600
3 SASI_Mm01_00124041 predicted 426
4 SASI_Mm01_00124042 predicted 1858
5 SASI_Mm01_00124043 predicted 545
6 SASI_Mm01_00124044 predicted 1859
7 SASI_Mm01_00124045 predicted 1303
8 SASI_Mm02_00332868 predicted 451
9 SASI_Mm01_00124046 predicted 1303
10 SASI_Mm01_00124047 predicted 441
11 SASI_Mm01_00124048 predicted 1818
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027897
RHPN2 MISSION shRNA Bacterial Glycerol Stock
rhophilin, Rho GTPase binding protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027897.2-2529s1c1
Sequence:CCGGCCACCTACTTTGGTACTATATCTCGAGATATAGTACCAAAGTAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027897.2-669s1c1
Sequence:CCGGGCCAGCGTTCTCTTCAACATTCTCGAGAATGTTGAAGAGAACGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027897.2-339s1c1
Sequence:CCGGGCGTTCACCATTCCTCTGATTCTCGAGAATCAGAGGAATGGTGAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027897.2-1401s1c1
Sequence:CCGGGACGACCTTCTGAACCTGATTCTCGAGAATCAGGTTCAGAAGGTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027897.2-1820s1c1
Sequence:CCGGGCATAATAAGTGTGCCACTTACTCGAGTAAGTGGCACACTTATTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027897.4-164s21c1
Sequence:CCGGTACTTTCGAAAGGGTTGTAATCTCGAGATTACAACCCTTTCGAAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027897.4-2373s21c1
Sequence:CCGGGGCATAGAAGAGCCTGAATATCTCGAGATATTCAGGCTCTTCTATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027897.4-1395s21c1
Sequence:CCGGGCAAGAAGCTGCGTGACATTCCTCGAGGAATGTCACGCAGCTTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027897
RHPN2 MISSION shRNA shRNA Plasmid DNA
rhophilin, Rho GTPase binding protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027897.2-2529s1c1
Sequence:CCGGCCACCTACTTTGGTACTATATCTCGAGATATAGTACCAAAGTAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027897.2-669s1c1
Sequence:CCGGGCCAGCGTTCTCTTCAACATTCTCGAGAATGTTGAAGAGAACGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027897.2-339s1c1
Sequence:CCGGGCGTTCACCATTCCTCTGATTCTCGAGAATCAGAGGAATGGTGAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027897.2-1401s1c1
Sequence:CCGGGACGACCTTCTGAACCTGATTCTCGAGAATCAGGTTCAGAAGGTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027897.2-1820s1c1
Sequence:CCGGGCATAATAAGTGTGCCACTTACTCGAGTAAGTGGCACACTTATTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027897.4-164s21c1
Sequence:CCGGTACTTTCGAAAGGGTTGTAATCTCGAGATTACAACCCTTTCGAAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027897.4-2373s21c1
Sequence:CCGGGGCATAGAAGAGCCTGAATATCTCGAGATATTCAGGCTCTTCTATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027897.4-1395s21c1
Sequence:CCGGGCAAGAAGCTGCGTGACATTCCTCGAGGAATGTCACGCAGCTTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027897
RHPN2 MISSION shRNA Lentiviral Transduction Particles
rhophilin, Rho GTPase binding protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027897.2-2529s1c1
Sequence:CCGGCCACCTACTTTGGTACTATATCTCGAGATATAGTACCAAAGTAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027897.2-669s1c1
Sequence:CCGGGCCAGCGTTCTCTTCAACATTCTCGAGAATGTTGAAGAGAACGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027897.2-339s1c1
Sequence:CCGGGCGTTCACCATTCCTCTGATTCTCGAGAATCAGAGGAATGGTGAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027897.2-1401s1c1
Sequence:CCGGGACGACCTTCTGAACCTGATTCTCGAGAATCAGGTTCAGAAGGTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027897.2-1820s1c1
Sequence:CCGGGCATAATAAGTGTGCCACTTACTCGAGTAAGTGGCACACTTATTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027897.4-164s21c1
Sequence:CCGGTACTTTCGAAAGGGTTGTAATCTCGAGATTACAACCCTTTCGAAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027897.4-2373s21c1
Sequence:CCGGGGCATAGAAGAGCCTGAATATCTCGAGATATTCAGGCTCTTCTATGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027897.4-1395s21c1
Sequence:CCGGGCAAGAAGCTGCGTGACATTCCTCGAGGAATGTCACGCAGCTTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033103
VALIDATED
RHPN2 MISSION shRNA Bacterial Glycerol Stock
rhophilin, Rho GTPase binding protein 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033103.3-144s1c1
Sequence:CCGGGCAGAATCAAAGAGCTGCTTTCTCGAGAAAGCAGCTCTTTGATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_033103.3-1897s1c1
Sequence:CCGGGCCATTGATGATGACGACAAACTCGAGTTTGTCGTCATCATCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033103.3-133s1c1
Sequence:CCGGCGGAGTAAATTGCAGAATCAACTCGAGTTGATTCTGCAATTTACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033103.3-1836s1c1
Sequence:CCGGGCATAATAAGAGTGCCACATACTCGAGTATGTGGCACTCTTATTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033103.3-2066s1c1
Sequence:CCGGGCCTTCTCAACTCAGACAGTTCTCGAGAACTGTCTGAGTTGAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_033103.4-2457s21c1
Sequence:CCGGTACCTATATCAGTACAATTTGCTCGAGCAAATTGTACTGATATAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_033103.4-165s21c1
Sequence:CCGGGAGTAAATTGCAGAATCAAAGCTCGAGCTTTGATTCTGCAATTTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033103.4-2108s21c1
Sequence:CCGGCAGACAGTTCTTGGTACTAATCTCGAGATTAGTACCAAGAACTGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_033103.4-194s21c1
Sequence:CCGGTGAATCAGCAGATCCTGAAAGCTCGAGCTTTCAGGATCTGCTGATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033103.4-2483s21c1
Sequence:CCGGGTTTCCAGGTTTGGCTAATAACTCGAGTTATTAGCCAAACCTGGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_033103.4-110s21c1
Sequence:CCGGAGGAGAACGACGGCTACTTTCCTCGAGGAAAGTAGCCGTCGTTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033103.4-244s21c1
Sequence:CCGGCTTCTGAAAGTGGCCACAAACCTCGAGGTTTGTGGCCACTTTCAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_033103.4-601s21c1
Sequence:CCGGGGCTTTGTCGAGAGTCGATTCCTCGAGGAATCGACTCTCGACAAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033103
VALIDATED
RHPN2 MISSION shRNA shRNA Plasmid DNA
rhophilin, Rho GTPase binding protein 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033103.3-144s1c1
Sequence:CCGGGCAGAATCAAAGAGCTGCTTTCTCGAGAAAGCAGCTCTTTGATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_033103.3-1897s1c1
Sequence:CCGGGCCATTGATGATGACGACAAACTCGAGTTTGTCGTCATCATCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033103.3-133s1c1
Sequence:CCGGCGGAGTAAATTGCAGAATCAACTCGAGTTGATTCTGCAATTTACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033103.3-1836s1c1
Sequence:CCGGGCATAATAAGAGTGCCACATACTCGAGTATGTGGCACTCTTATTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033103.3-2066s1c1
Sequence:CCGGGCCTTCTCAACTCAGACAGTTCTCGAGAACTGTCTGAGTTGAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_033103.4-2457s21c1
Sequence:CCGGTACCTATATCAGTACAATTTGCTCGAGCAAATTGTACTGATATAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_033103.4-165s21c1
Sequence:CCGGGAGTAAATTGCAGAATCAAAGCTCGAGCTTTGATTCTGCAATTTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033103.4-2108s21c1
Sequence:CCGGCAGACAGTTCTTGGTACTAATCTCGAGATTAGTACCAAGAACTGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_033103.4-194s21c1
Sequence:CCGGTGAATCAGCAGATCCTGAAAGCTCGAGCTTTCAGGATCTGCTGATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033103.4-2483s21c1
Sequence:CCGGGTTTCCAGGTTTGGCTAATAACTCGAGTTATTAGCCAAACCTGGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_033103.4-110s21c1
Sequence:CCGGAGGAGAACGACGGCTACTTTCCTCGAGGAAAGTAGCCGTCGTTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033103.4-244s21c1
Sequence:CCGGCTTCTGAAAGTGGCCACAAACCTCGAGGTTTGTGGCCACTTTCAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_033103.4-601s21c1
Sequence:CCGGGGCTTTGTCGAGAGTCGATTCCTCGAGGAATCGACTCTCGACAAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033103
VALIDATED
RHPN2 MISSION shRNA Lentiviral Transduction Particles
rhophilin, Rho GTPase binding protein 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033103.3-144s1c1
Sequence:CCGGGCAGAATCAAAGAGCTGCTTTCTCGAGAAAGCAGCTCTTTGATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_033103.3-1897s1c1
Sequence:CCGGGCCATTGATGATGACGACAAACTCGAGTTTGTCGTCATCATCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033103.3-133s1c1
Sequence:CCGGCGGAGTAAATTGCAGAATCAACTCGAGTTGATTCTGCAATTTACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033103.3-1836s1c1
Sequence:CCGGGCATAATAAGAGTGCCACATACTCGAGTATGTGGCACTCTTATTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033103.3-2066s1c1
Sequence:CCGGGCCTTCTCAACTCAGACAGTTCTCGAGAACTGTCTGAGTTGAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_033103.4-2457s21c1
Sequence:CCGGTACCTATATCAGTACAATTTGCTCGAGCAAATTGTACTGATATAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_033103.4-165s21c1
Sequence:CCGGGAGTAAATTGCAGAATCAAAGCTCGAGCTTTGATTCTGCAATTTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033103.4-2108s21c1
Sequence:CCGGCAGACAGTTCTTGGTACTAATCTCGAGATTAGTACCAAGAACTGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_033103.4-194s21c1
Sequence:CCGGTGAATCAGCAGATCCTGAAAGCTCGAGCTTTCAGGATCTGCTGATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033103.4-2483s21c1
Sequence:CCGGGTTTCCAGGTTTGGCTAATAACTCGAGTTATTAGCCAAACCTGGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_033103.4-110s21c1
Sequence:CCGGAGGAGAACGACGGCTACTTTCCTCGAGGAAAGTAGCCGTCGTTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033103.4-244s21c1
Sequence:CCGGCTTCTGAAAGTGGCCACAAACCTCGAGGTTTGTGGCCACTTTCAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_033103.4-601s21c1
Sequence:CCGGGGCTTTGTCGAGAGTCGATTCCTCGAGGAATCGACTCTCGACAAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)