EMAIL THIS PAGE TO A FRIEND

RIBC1

RIB43A domain with coiled-coils 1

72 Gene Product Result for
Synonyms: 2610028I09Rik
UniProtKB ID: Q8N443, B4E297, E9PDU2, Q5H931, Q96A80
Gene ID:
Mouse(66611) RIB43A domain with coiled-coils 1
Rat(317431) RIB43A domain with coiled-coils 1
Zebrafish(791181) RIB43A domain with coiled-coils 1
dog(480929) RIB43A domain with coiled-coils 1
domestic cat(101090418) RIB43A domain with coiled-coils 1
cow(512894) RIB43A domain with coiled-coils 1
sheep(101120302) RIB43A domain with coiled-coils 1
domestic guinea pig(100722860) RIB43A domain with coiled-coils 1
naked mole-rat(101712873) RIB43A domain with coiled-coils 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144968 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144968 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144968 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025660 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025660 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025660 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031745 Rosetta Predictions human pricing
NM_144968 Rosetta Predictions human pricing
NM_001007715 Rosetta Predictions rat pricing
NM_025660 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145019 predicted 325
2 SASI_Hs01_00145020 predicted 463
3 SASI_Hs01_00145021 predicted 412
4 SASI_Hs01_00145022 predicted 391
5 SASI_Hs01_00145023 predicted 423
6 SASI_Hs01_00145024 predicted 373
7 SASI_Hs01_00145025 predicted 301
8 SASI_Hs01_00145026 predicted 371
9 SASI_Hs01_00145027 predicted 460
10 SASI_Hs01_00145028 predicted 462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144968 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047285 predicted 373
2 SASI_Hs01_00047286 predicted 515
3 SASI_Hs01_00047287 predicted 463
4 SASI_Hs01_00047288 predicted 439
5 SASI_Hs01_00047289 predicted 476
6 SASI_Hs01_00047290 predicted 428
7 SASI_Hs01_00047291 predicted 353
8 SASI_Hs01_00047292 predicted 420
9 SASI_Hs01_00047293 predicted 514
10 SASI_Hs01_00047294 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007715 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051094 predicted 242
2 SASI_Rn01_00051095 predicted 342
3 SASI_Rn01_00051096 predicted 358
4 SASI_Rn01_00051097 predicted 327
5 SASI_Rn01_00051098 predicted 525
6 SASI_Rn01_00051099 predicted 698
7 SASI_Rn01_00051100 predicted 974
8 SASI_Rn01_00051101 predicted 522
9 SASI_Rn01_00051102 predicted 208
10 SASI_Rn01_00051103 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025660 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041766 predicted 389
2 SASI_Mm01_00041767 predicted 372
3 SASI_Mm01_00041768 predicted 665
4 SASI_Mm01_00041769 predicted 303
5 SASI_Mm01_00041770 predicted 976
6 SASI_Mm01_00041771 predicted 949
7 SASI_Mm01_00041772 predicted 401
8 SASI_Mm01_00041774 predicted 914
9 SASI_Mm01_00041775 predicted 235
10 SASI_Mm02_00328795 predicted 594
11 SASI_Mm01_00041773 predicted 950
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144968
RIBC1 MISSION shRNA Bacterial Glycerol Stock
RIB43A domain with coiled-coils 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144968.1-297s21c1
Sequence:CCGGCAATGTGCGGAACCGAGTCATCTCGAGATGACTCGGTTCCGCACATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144968.1-943s21c1
Sequence:CCGGGATTAGTTTGGCACTCCATTACTCGAGTAATGGAGTGCCAAACTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144968.1-1090s21c1
Sequence:CCGGCATAGAGTAGCTACTATTATGCTCGAGCATAATAGTAGCTACTCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144968.1-1252s21c1
Sequence:CCGGGTAGCTAATTGTGAAAGTATTCTCGAGAATACTTTCACAATTAGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144968.1-570s1c1
Sequence:CCGGGCTTCCAACCTATCTTAGTTACTCGAGTAACTAAGATAGGTTGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144968.1-575s1c1
Sequence:CCGGCAACCTATCTTAGTTACAGTACTCGAGTACTGTAACTAAGATAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144968.1-247s1c1
Sequence:CCGGGCCATCGAGGCTAGAAGAAATCTCGAGATTTCTTCTAGCCTCGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144968.1-529s1c1
Sequence:CCGGCGTGAATTTAGTCTTTGGGATCTCGAGATCCCAAAGACTAAATTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144968.1-724s1c1
Sequence:CCGGGCCAAGGTTGATGAGAATTATCTCGAGATAATTCTCATCAACCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144968
RIBC1 MISSION shRNA shRNA Plasmid DNA
RIB43A domain with coiled-coils 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144968.1-297s21c1
Sequence:CCGGCAATGTGCGGAACCGAGTCATCTCGAGATGACTCGGTTCCGCACATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144968.1-943s21c1
Sequence:CCGGGATTAGTTTGGCACTCCATTACTCGAGTAATGGAGTGCCAAACTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144968.1-1090s21c1
Sequence:CCGGCATAGAGTAGCTACTATTATGCTCGAGCATAATAGTAGCTACTCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144968.1-1252s21c1
Sequence:CCGGGTAGCTAATTGTGAAAGTATTCTCGAGAATACTTTCACAATTAGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144968.1-570s1c1
Sequence:CCGGGCTTCCAACCTATCTTAGTTACTCGAGTAACTAAGATAGGTTGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144968.1-575s1c1
Sequence:CCGGCAACCTATCTTAGTTACAGTACTCGAGTACTGTAACTAAGATAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144968.1-247s1c1
Sequence:CCGGGCCATCGAGGCTAGAAGAAATCTCGAGATTTCTTCTAGCCTCGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144968.1-529s1c1
Sequence:CCGGCGTGAATTTAGTCTTTGGGATCTCGAGATCCCAAAGACTAAATTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144968.1-724s1c1
Sequence:CCGGGCCAAGGTTGATGAGAATTATCTCGAGATAATTCTCATCAACCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144968
RIBC1 MISSION shRNA Lentiviral Transduction Particles
RIB43A domain with coiled-coils 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144968.1-297s21c1
Sequence:CCGGCAATGTGCGGAACCGAGTCATCTCGAGATGACTCGGTTCCGCACATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144968.1-943s21c1
Sequence:CCGGGATTAGTTTGGCACTCCATTACTCGAGTAATGGAGTGCCAAACTAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144968.1-1090s21c1
Sequence:CCGGCATAGAGTAGCTACTATTATGCTCGAGCATAATAGTAGCTACTCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430963    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144968.1-1252s21c1
Sequence:CCGGGTAGCTAATTGTGAAAGTATTCTCGAGAATACTTTCACAATTAGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144968.1-570s1c1
Sequence:CCGGGCTTCCAACCTATCTTAGTTACTCGAGTAACTAAGATAGGTTGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144968.1-575s1c1
Sequence:CCGGCAACCTATCTTAGTTACAGTACTCGAGTACTGTAACTAAGATAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144968.1-247s1c1
Sequence:CCGGGCCATCGAGGCTAGAAGAAATCTCGAGATTTCTTCTAGCCTCGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144968.1-529s1c1
Sequence:CCGGCGTGAATTTAGTCTTTGGGATCTCGAGATCCCAAAGACTAAATTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144968.1-724s1c1
Sequence:CCGGGCCAAGGTTGATGAGAATTATCTCGAGATAATTCTCATCAACCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025660
RIBC1 MISSION shRNA Bacterial Glycerol Stock
RIB43A domain with coiled-coils 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025660.2-429s21c1
Sequence:CCGGACCAAGCATGCGCACTATGATCTCGAGATCATAGTGCGCATGCTTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025660.2-1320s21c1
Sequence:CCGACAACCGACTGCGCACTATTACCTCGAGGTAATAGTGCGCAGTCGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025660.2-837s21c1
Sequence:CCGGGAATCCTGTCGAGCAGCTATGCTCGAGCATAGCTGCTCGACAGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025660.2-590s21c1
Sequence:CCGGGGAGTTTCGGGTCCCTTATTACTCGAGTAATAAGGGACCCGAAACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025660.1-990s1c1
Sequence:CCGGGAGAATCCTCAAGTTGCCCAACTCGAGTTGGGCAACTTGAGGATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025660.1-381s1c1
Sequence:CCGGCGAAAGTTTCGGGAGGCAATACTCGAGTATTGCCTCCCGAAACTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025660.1-311s1c1
Sequence:CCGGCCGATTCTTCAATGTGCGGAACTCGAGTTCCGCACATTGAAGAATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025660.1-984s1c1
Sequence:CCGGCTGACTGAGAATCCTCAAGTTCTCGAGAACTTGAGGATTCTCAGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025660
RIBC1 MISSION shRNA shRNA Plasmid DNA
RIB43A domain with coiled-coils 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025660.2-429s21c1
Sequence:CCGGACCAAGCATGCGCACTATGATCTCGAGATCATAGTGCGCATGCTTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025660.2-1320s21c1
Sequence:CCGACAACCGACTGCGCACTATTACCTCGAGGTAATAGTGCGCAGTCGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025660.2-837s21c1
Sequence:CCGGGAATCCTGTCGAGCAGCTATGCTCGAGCATAGCTGCTCGACAGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025660.2-590s21c1
Sequence:CCGGGGAGTTTCGGGTCCCTTATTACTCGAGTAATAAGGGACCCGAAACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025660.1-990s1c1
Sequence:CCGGGAGAATCCTCAAGTTGCCCAACTCGAGTTGGGCAACTTGAGGATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025660.1-381s1c1
Sequence:CCGGCGAAAGTTTCGGGAGGCAATACTCGAGTATTGCCTCCCGAAACTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025660.1-311s1c1
Sequence:CCGGCCGATTCTTCAATGTGCGGAACTCGAGTTCCGCACATTGAAGAATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025660.1-984s1c1
Sequence:CCGGCTGACTGAGAATCCTCAAGTTCTCGAGAACTTGAGGATTCTCAGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025660
RIBC1 MISSION shRNA Lentiviral Transduction Particles
RIB43A domain with coiled-coils 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025660.2-429s21c1
Sequence:CCGGACCAAGCATGCGCACTATGATCTCGAGATCATAGTGCGCATGCTTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025660.2-1320s21c1
Sequence:CCGACAACCGACTGCGCACTATTACCTCGAGGTAATAGTGCGCAGTCGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025660.2-837s21c1
Sequence:CCGGGAATCCTGTCGAGCAGCTATGCTCGAGCATAGCTGCTCGACAGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025660.2-590s21c1
Sequence:CCGGGGAGTTTCGGGTCCCTTATTACTCGAGTAATAAGGGACCCGAAACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025660.1-990s1c1
Sequence:CCGGGAGAATCCTCAAGTTGCCCAACTCGAGTTGGGCAACTTGAGGATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025660.1-381s1c1
Sequence:CCGGCGAAAGTTTCGGGAGGCAATACTCGAGTATTGCCTCCCGAAACTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025660.1-311s1c1
Sequence:CCGGCCGATTCTTCAATGTGCGGAACTCGAGTTCCGCACATTGAAGAATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025660.1-984s1c1
Sequence:CCGGCTGACTGAGAATCCTCAAGTTCTCGAGAACTTGAGGATTCTCAGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)