EMAIL THIS PAGE TO A FRIEND

RIBC2

RIB43A domain with coiled-coils 2

55 Gene Product Result for
Synonyms: C22orf11
UniProtKB ID: Q9H4K1, Q6ICD0, Q9Y413
Gene ID:
Mouse(67747) RIB43A domain with coiled-coils 2
Rat(300122) RIB43A domain with coiled-coils 2
naked mole-rat(101698341) RIB43A domain with coiled-coils 2
domestic guinea pig(100721929) RIB43A domain with coiled-coils 2
cow(540723) RIB43A domain with coiled-coils 2
sheep(101120317) RIB43A domain with coiled-coils 2
chicken(418244) RIB43A domain with coiled-coils 2
domestic cat(101095113) RIB43A domain with coiled-coils 2
dog(474469) RIB43A domain with coiled-coils 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026357 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026357 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026357 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015653 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015653 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015653 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005621 MISSION® esiRNA esiRNA targeting human RIBC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015653 Rosetta Predictions human pricing
NM_001013949 Rosetta Predictions rat pricing
XM_283290 Rosetta Predictions mouse pricing
XM_911372 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159043 predicted 821
2 SASI_Hs01_00159044 predicted 705
3 SASI_Hs01_00159045 predicted 651
4 SASI_Hs01_00159046 predicted 829
5 SASI_Hs01_00159049 predicted 625
6 SASI_Hs01_00159050 predicted 906
7 SASI_Hs01_00159051 predicted 704
8 SASI_Hs02_00348262 predicted 506
9 SASI_Hs01_00159052 predicted 907
10 SASI_Hs02_00348263 predicted 1011
11 SASI_Hs01_00159047 predicted 1052
12 SASI_Hs01_00159048 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013949 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201261 predicted 806
2 SASI_Rn02_00201262 predicted 732
3 SASI_Rn01_00104096 predicted 435
4 SASI_Rn01_00104097 predicted 479
5 SASI_Rn01_00104098 predicted 448
6 SASI_Rn01_00104100 predicted 385
7 SASI_Rn01_00104101 predicted 709
8 SASI_Rn01_00104102 predicted 543
9 SASI_Rn01_00104103 predicted 489
10 SASI_Rn01_00104104 predicted 876
11 SASI_Rn01_00104095 predicted 574
12 SASI_Rn01_00104099 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283290 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229266 predicted 703
2 SASI_Mm01_00229267 predicted 504
3 SASI_Mm01_00229268 predicted 370
4 SASI_Mm01_00229269 predicted 725
5 SASI_Mm01_00229270 predicted 447
6 SASI_Mm01_00229271 predicted 603
7 SASI_Mm01_00229272 predicted 579
8 SASI_Mm01_00229273 predicted 462
9 SASI_Mm01_00229274 predicted 737
10 SASI_Mm01_00229275 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_911372 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436400 predicted 1362
2 SASI_Mm02_00436401 predicted 1030
3 SASI_Mm02_00436402 predicted 720
4 SASI_Mm02_00436403 predicted 449
5 SASI_Mm02_00436404 predicted 607
6 SASI_Mm02_00436405 predicted 1265
7 SASI_Mm02_00436406 predicted 463
8 SASI_Mm02_00436407 predicted 1286
9 SASI_Mm02_00436408 predicted 900
10 SASI_Mm02_00436409 predicted 555
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026357
RIBC2 MISSION shRNA Bacterial Glycerol Stock
RIB43A domain with coiled-coils 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026357.2-1255s21c1
Sequence:CCGGCAGCCCACAGAAGACTATTTCCTCGAGGAAATAGTCTTCTGTGGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026357.2-1336s21c1
Sequence:CCGGCCTCTAGGAGTCACGCTTATTCTCGAGAATAAGCGTGACTCCTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026357.2-1023s21c1
Sequence:CCGGGTTCACGCAGAAGCGGCAAATCTCGAGATTTGCCGCTTCTGCGTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026357.2-434s21c1
Sequence:CCGGAGCTGTGTAGAGCTATCAATGCTCGAGCATTGATAGCTCTACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026357.2-588s21c1
Sequence:CCGGGTTCATGGGAGAGGATTTAAACTCGAGTTTAAATCCTCTCCCATGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026357
RIBC2 MISSION shRNA shRNA Plasmid DNA
RIB43A domain with coiled-coils 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026357.2-1255s21c1
Sequence:CCGGCAGCCCACAGAAGACTATTTCCTCGAGGAAATAGTCTTCTGTGGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026357.2-1336s21c1
Sequence:CCGGCCTCTAGGAGTCACGCTTATTCTCGAGAATAAGCGTGACTCCTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026357.2-1023s21c1
Sequence:CCGGGTTCACGCAGAAGCGGCAAATCTCGAGATTTGCCGCTTCTGCGTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026357.2-434s21c1
Sequence:CCGGAGCTGTGTAGAGCTATCAATGCTCGAGCATTGATAGCTCTACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026357.2-588s21c1
Sequence:CCGGGTTCATGGGAGAGGATTTAAACTCGAGTTTAAATCCTCTCCCATGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026357
RIBC2 MISSION shRNA Lentiviral Transduction Particles
RIB43A domain with coiled-coils 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026357.2-1255s21c1
Sequence:CCGGCAGCCCACAGAAGACTATTTCCTCGAGGAAATAGTCTTCTGTGGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026357.2-1336s21c1
Sequence:CCGGCCTCTAGGAGTCACGCTTATTCTCGAGAATAAGCGTGACTCCTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026357.2-1023s21c1
Sequence:CCGGGTTCACGCAGAAGCGGCAAATCTCGAGATTTGCCGCTTCTGCGTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026357.2-434s21c1
Sequence:CCGGAGCTGTGTAGAGCTATCAATGCTCGAGCATTGATAGCTCTACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026357.2-588s21c1
Sequence:CCGGGTTCATGGGAGAGGATTTAAACTCGAGTTTAAATCCTCTCCCATGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015653
VALIDATED
RIBC2 MISSION shRNA Bacterial Glycerol Stock
RIB43A domain with coiled-coils 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015653.2-468s21c1
Sequence:CCGGATCTCTGTAGGGCTATCAATGCTCGAGCATTGATAGCCCTACAGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015653.2-622s21c1
Sequence:CCGGATTCATGGGAGAGGATTTAAACTCGAGTTTAAATCCTCTCCCATGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015653.2-582s21c1
Sequence:CCGGCAGATAATGATGTTCGGAATACTCGAGTATTCCGAACATCATTATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015653.2-1057s21c1
Sequence:CCGGCCTAGTCCAGAAGCAGCAAATCTCGAGATTTGCTGCTTCTGGACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_015653.2-512s21c1
Sequence:CCGGCCAGAAACTCGCCGTGAATTTCTCGAGAAATTCACGGCGAGTTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015653.1-553s1c1
Sequence:CCGGCAGATAATGATGTTCGGAATACTCGAGTATTCCGAACATCATTATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015653
VALIDATED
RIBC2 MISSION shRNA shRNA Plasmid DNA
RIB43A domain with coiled-coils 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015653.2-468s21c1
Sequence:CCGGATCTCTGTAGGGCTATCAATGCTCGAGCATTGATAGCCCTACAGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015653.2-622s21c1
Sequence:CCGGATTCATGGGAGAGGATTTAAACTCGAGTTTAAATCCTCTCCCATGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015653.2-582s21c1
Sequence:CCGGCAGATAATGATGTTCGGAATACTCGAGTATTCCGAACATCATTATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015653.2-1057s21c1
Sequence:CCGGCCTAGTCCAGAAGCAGCAAATCTCGAGATTTGCTGCTTCTGGACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_015653.2-512s21c1
Sequence:CCGGCCAGAAACTCGCCGTGAATTTCTCGAGAAATTCACGGCGAGTTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015653.1-553s1c1
Sequence:CCGGCAGATAATGATGTTCGGAATACTCGAGTATTCCGAACATCATTATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015653
VALIDATED
RIBC2 MISSION shRNA Lentiviral Transduction Particles
RIB43A domain with coiled-coils 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015653.2-468s21c1
Sequence:CCGGATCTCTGTAGGGCTATCAATGCTCGAGCATTGATAGCCCTACAGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015653.2-622s21c1
Sequence:CCGGATTCATGGGAGAGGATTTAAACTCGAGTTTAAATCCTCTCCCATGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015653.2-582s21c1
Sequence:CCGGCAGATAATGATGTTCGGAATACTCGAGTATTCCGAACATCATTATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015653.2-1057s21c1
Sequence:CCGGCCTAGTCCAGAAGCAGCAAATCTCGAGATTTGCTGCTTCTGGACTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_015653.2-512s21c1
Sequence:CCGGCCAGAAACTCGCCGTGAATTTCTCGAGAAATTCACGGCGAGTTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015653.1-553s1c1
Sequence:CCGGCAGATAATGATGTTCGGAATACTCGAGTATTCCGAACATCATTATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)