EMAIL THIS PAGE TO A FRIEND

RICTOR

RPTOR independent companion of MTOR, complex 2

285 Gene Product Result for
Synonyms: PIA mAVO3
Gene ID:
Human(253260) Summary: RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]
Mouse(78757) RPTOR independent companion of MTOR, complex 2
Rat(310131) RPTOR independent companion of MTOR, complex 2
fruit fly(32919) rapamycin-insensitive companion of Tor
dog(479356) RPTOR independent companion of MTOR, complex 2
chicken(427447) RPTOR independent companion of MTOR, complex 2
domestic cat(101096206) RPTOR independent companion of MTOR, complex 2
cow(527459) RPTOR independent companion of MTOR, complex 2
sheep(101105528) RPTOR independent companion of MTOR, complex 2
naked mole-rat(101718794) RPTOR independent companion of MTOR, complex 2
domestic guinea pig(100715888) RPTOR independent companion of MTOR, complex 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500884 Anti-Rictor antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine, mouse
ELISA, immunohistochemistry pricing
SAB4200141 Anti-Rictor antibody produced in rabbit ~1-2 μg/mL, affinity isolated antibody rat, mouse, human
immunohistochemistry, immunoprecipitation (IP), western blot pricing
HPA037803 Anti-RICTOR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA037802 Anti-RICTOR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1410465 Anti-RICTOR antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
proximity ligation assay, western blot pricing
WH0253260M1 Monoclonal Anti-RICTOR antibody produced in mouse clone 1F3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5300210 Monoclonal Anti-RICTOR antibody produced in mouse clone 7B3, ascites fluid monkey, human, mouse
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB5300211 Monoclonal Anti-RICTOR antibody produced in mouse clone 4H5, ascites fluid human, mouse, monkey
ELISA, western blot pricing
PLA0309 Mouse anti-Rictor Monoclonal Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc., clone IG3P2C9 human
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing

Cell Lines

Product # Description Species Add to Cart
 
CLLS1053 MCF10A CELLS RICTOR (-/-) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030168 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030168 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030168 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152756 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152756 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152756 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152756 Rosetta Predictions human pricing
XM_001055633 Rosetta Predictions rat pricing
XM_226812 Rosetta Predictions rat pricing
NM_030168 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366683 predicted 3681
2 SASI_Hs01_00223573 predicted 895
3 SASI_Hs01_00223574 predicted 2661
4 SASI_Hs02_00366684 predicted 1713
5 SASI_Hs01_00223575 predicted 4838
6 SASI_Hs01_00223576 predicted 4623
7 SASI_Hs01_00223577 predicted 3924
8 SASI_Hs01_00223578 predicted 1473
9 SASI_Hs01_00223579 predicted 3081
10 SASI_Hs01_00223581 predicted 2566
11 SASI_Hs01_00223580 predicted 648
12 SASI_Hs01_00223582 predicted 3145
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055633 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280399 predicted 2846
2 SASI_Rn02_00280400 predicted 528
3 SASI_Rn02_00280401 predicted 2548
4 SASI_Rn02_00280402 predicted 1551
5 SASI_Rn02_00280403 predicted 3621
6 SASI_Rn02_00280404 predicted 3386
7 SASI_Rn02_00280405 predicted 1874
8 SASI_Rn02_00280406 predicted 3675
9 SASI_Rn02_00280407 predicted 4510
10 SASI_Rn02_00280408 predicted 2040
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226812 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383895 predicted 2846
2 SASI_Rn02_00383896 predicted 4541
3 SASI_Rn02_00383897 predicted 2547
4 SASI_Rn02_00383898 predicted 4082
5 SASI_Rn02_00383899 predicted 3621
6 SASI_Rn02_00383900 predicted 3390
7 SASI_Rn02_00383901 predicted 1881
8 SASI_Rn02_00383902 predicted 3671
9 SASI_Rn02_00383903 predicted 4505
10 SASI_Rn02_00383904 predicted 4756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137729 predicted 854
2 SASI_Mm01_00137730 predicted 639
3 SASI_Mm01_00137731 predicted 3778
4 SASI_Mm01_00137732 predicted 4651
5 SASI_Mm02_00336579 predicted 2663
6 SASI_Mm01_00137733 predicted 223
7 SASI_Mm01_00137734 predicted 1991
8 SASI_Mm01_00137735 predicted 202
9 SASI_Mm01_00137736 predicted 663
10 SASI_Mm02_00336580 predicted 957
11 SASI_Mm01_00137737 predicted 3308
12 SASI_Mm01_00137738 predicted 2918
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030168
VALIDATED
RICTOR MISSION shRNA Bacterial Glycerol Stock
RPTOR independent companion of MTOR, complex 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030168.2-6240s1c1
Sequence:CCGGCGAGACTTTGTCTGTCTAATTCTCGAGAATTAGACAGACAAAGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030168.2-867s1c1
Sequence:CCGGGCCAGTAAGATGGGAATCATTCTCGAGAATGATTCCCATCTTACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030168.2-193s1c1
Sequence:CCGGGCCATCTGAATAACTTCACTACTCGAGTAGTGAAGTTATTCAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030168.2-5030s1c1
Sequence:CCGGGCGGTTCATACAAGAGTTATTCTCGAGAATAACTCTTGTATGAACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030168.2-5031s1c1
Sequence:CCGGCGGTTCATACAAGAGTTATTTCTCGAGAAATAACTCTTGTATGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030168
VALIDATED
RICTOR MISSION shRNA shRNA Plasmid DNA
RPTOR independent companion of MTOR, complex 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030168.2-6240s1c1
Sequence:CCGGCGAGACTTTGTCTGTCTAATTCTCGAGAATTAGACAGACAAAGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030168.2-867s1c1
Sequence:CCGGGCCAGTAAGATGGGAATCATTCTCGAGAATGATTCCCATCTTACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030168.2-193s1c1
Sequence:CCGGGCCATCTGAATAACTTCACTACTCGAGTAGTGAAGTTATTCAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030168.2-5030s1c1
Sequence:CCGGGCGGTTCATACAAGAGTTATTCTCGAGAATAACTCTTGTATGAACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030168.2-5031s1c1
Sequence:CCGGCGGTTCATACAAGAGTTATTTCTCGAGAAATAACTCTTGTATGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030168
VALIDATED
RICTOR MISSION shRNA Lentiviral Transduction Particles
RPTOR independent companion of MTOR, complex 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030168.2-6240s1c1
Sequence:CCGGCGAGACTTTGTCTGTCTAATTCTCGAGAATTAGACAGACAAAGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030168.2-867s1c1
Sequence:CCGGGCCAGTAAGATGGGAATCATTCTCGAGAATGATTCCCATCTTACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030168.2-193s1c1
Sequence:CCGGGCCATCTGAATAACTTCACTACTCGAGTAGTGAAGTTATTCAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030168.2-5030s1c1
Sequence:CCGGGCGGTTCATACAAGAGTTATTCTCGAGAATAACTCTTGTATGAACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030168.2-5031s1c1
Sequence:CCGGCGGTTCATACAAGAGTTATTTCTCGAGAAATAACTCTTGTATGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152756
VALIDATED
RICTOR MISSION shRNA Bacterial Glycerol Stock
RPTOR independent companion of MTOR, complex 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_152756.3-2617s21c1
Sequence:CCGGCGTCGGAGTAACCAAAGATTACTCGAGTAATCTTTGGTTACTCCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152756.3-900s21c1
Sequence:CCGGCCGATCATGGGCAGGTATTATCTCGAGATAATACCTGCCCATGATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_152756.2-5276s1c1
Sequence:CCGGCCGCAGTTACTGGTACATGAACTCGAGTTCATGTACCAGTAACTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152756.2-2620s1c1
Sequence:CCGGCGTCGGAGTAACCAAAGATTACTCGAGTAATCTTTGGTTACTCCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_152756.2-3940s1c1
Sequence:CCGGGCACCCTCTATTGCTACAATTCTCGAGAATTGTAGCAATAGAGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_152756.2-5035s1c1
Sequence:CCGGCGGAGGTTCATACAAGAATTACTCGAGTAATTCTTGTATGAACCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152756.2-1379s1c1
Sequence:CCGGCCCTAATGAATATGGCTGCATCTCGAGATGCAGCCATATTCATTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_152756.3-5273s21c1
Sequence:CCGGCCGCAGTTACTGGTACATGAACTCGAGTTCATGTACCAGTAACTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_152756.3-3937s21c1
Sequence:CCGGGCACCCTCTATTGCTACAATTCTCGAGAATTGTAGCAATAGAGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_152756.3-5032s21c1
Sequence:CCGGCGGAGGTTCATACAAGAATTACTCGAGTAATTCTTGTATGAACCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152756
VALIDATED
RICTOR MISSION shRNA shRNA Plasmid DNA
RPTOR independent companion of MTOR, complex 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_152756.3-2617s21c1
Sequence:CCGGCGTCGGAGTAACCAAAGATTACTCGAGTAATCTTTGGTTACTCCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152756.3-900s21c1
Sequence:CCGGCCGATCATGGGCAGGTATTATCTCGAGATAATACCTGCCCATGATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_152756.2-5276s1c1
Sequence:CCGGCCGCAGTTACTGGTACATGAACTCGAGTTCATGTACCAGTAACTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152756.2-2620s1c1
Sequence:CCGGCGTCGGAGTAACCAAAGATTACTCGAGTAATCTTTGGTTACTCCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_152756.2-3940s1c1
Sequence:CCGGGCACCCTCTATTGCTACAATTCTCGAGAATTGTAGCAATAGAGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_152756.2-5035s1c1
Sequence:CCGGCGGAGGTTCATACAAGAATTACTCGAGTAATTCTTGTATGAACCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152756.2-1379s1c1
Sequence:CCGGCCCTAATGAATATGGCTGCATCTCGAGATGCAGCCATATTCATTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_152756.3-5273s21c1
Sequence:CCGGCCGCAGTTACTGGTACATGAACTCGAGTTCATGTACCAGTAACTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_152756.3-3937s21c1
Sequence:CCGGGCACCCTCTATTGCTACAATTCTCGAGAATTGTAGCAATAGAGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_152756.3-5032s21c1
Sequence:CCGGCGGAGGTTCATACAAGAATTACTCGAGTAATTCTTGTATGAACCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152756
VALIDATED
RICTOR MISSION shRNA Lentiviral Transduction Particles
RPTOR independent companion of MTOR, complex 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_152756.3-2617s21c1
Sequence:CCGGCGTCGGAGTAACCAAAGATTACTCGAGTAATCTTTGGTTACTCCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152756.3-900s21c1
Sequence:CCGGCCGATCATGGGCAGGTATTATCTCGAGATAATACCTGCCCATGATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_152756.2-5276s1c1
Sequence:CCGGCCGCAGTTACTGGTACATGAACTCGAGTTCATGTACCAGTAACTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152756.2-2620s1c1
Sequence:CCGGCGTCGGAGTAACCAAAGATTACTCGAGTAATCTTTGGTTACTCCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_152756.2-3940s1c1
Sequence:CCGGGCACCCTCTATTGCTACAATTCTCGAGAATTGTAGCAATAGAGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_152756.2-5035s1c1
Sequence:CCGGCGGAGGTTCATACAAGAATTACTCGAGTAATTCTTGTATGAACCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152756.2-1379s1c1
Sequence:CCGGCCCTAATGAATATGGCTGCATCTCGAGATGCAGCCATATTCATTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_152756.3-5273s21c1
Sequence:CCGGCCGCAGTTACTGGTACATGAACTCGAGTTCATGTACCAGTAACTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_152756.3-3937s21c1
Sequence:CCGGGCACCCTCTATTGCTACAATTCTCGAGAATTGTAGCAATAGAGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_152756.3-5032s21c1
Sequence:CCGGCGGAGGTTCATACAAGAATTACTCGAGTAATTCTTGTATGAACCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)