EMAIL THIS PAGE TO A FRIEND

RIF1

RAP1 interacting factor homolog (yeast)

62 Gene Product Result for
Gene ID:
Human(55183) Summary: This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
Mouse(51869) Rap1 interacting factor 1 homolog (yeast)
Rat(295602) RAP1 interacting factor homolog (yeast)
fruit fly(246445) Rap1 interacting factor 1 homolog
Horse(100057721) RAP1 interacting factor homolog (yeast)
domestic cat(101101071) RAP1 interacting factor homolog (yeast)
dog(476148) RAP1 interacting factor homolog (yeast)
dog(609234) RAP1 interacting factor homolog (yeast)
Zebrafish(567001) RAP1 interacting factor homolog (yeast)
chicken(424316) RAP1 interacting factor homolog (yeast)
domestic guinea pig(101787829) RAP1 interacting factor homolog (yeast)
naked mole-rat(101726637) RAP1 interacting factor homolog (yeast)
cow(541247) RAP1 interacting factor homolog (yeast)
sheep(101118926) RAP1 interacting factor homolog (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175238 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175238 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175238 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018151 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018151 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018151 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU095481 MISSION® esiRNA esiRNA human RIF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018151 Rosetta Predictions human pricing
XM_001065608 Rosetta Predictions rat pricing
XM_215736 Rosetta Predictions rat pricing
NM_175238 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212251 predicted 7084
2 SASI_Hs01_00212252 predicted 1281
3 SASI_Hs01_00212253 predicted 6321
4 SASI_Hs01_00212254 predicted 1352
5 SASI_Hs01_00212256 predicted 2368
6 SASI_Hs01_00212258 predicted 6792
7 SASI_Hs01_00212259 predicted 5307
8 SASI_Hs02_00351386 predicted 2622
9 SASI_Hs01_00212260 predicted 1631
10 SASI_Hs02_00351387 predicted 6990
11 SASI_Hs01_00212255 predicted 1918
12 SASI_Hs01_00212257 predicted 7463
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065608 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314824 predicted 4140
2 SASI_Rn02_00314825 predicted 5815
3 SASI_Rn02_00314826 predicted 214
4 SASI_Rn02_00314827 predicted 2369
5 SASI_Rn02_00314828 predicted 1852
6 SASI_Rn02_00314829 predicted 3528
7 SASI_Rn02_00314830 predicted 5415
8 SASI_Rn02_00314831 predicted 291
9 SASI_Rn02_00314832 predicted 3867
10 SASI_Rn02_00314833 predicted 6722
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215736 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376165 predicted 4139
2 SASI_Rn02_00376166 predicted 5818
3 SASI_Rn02_00376167 predicted 215
4 SASI_Rn02_00376168 predicted 2377
5 SASI_Rn02_00376169 predicted 1849
6 SASI_Rn02_00376170 predicted 3527
7 SASI_Rn02_00376171 predicted 5412
8 SASI_Rn02_00376172 predicted 299
9 SASI_Rn02_00376173 predicted 3866
10 SASI_Rn02_00376174 predicted 6725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175238 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345921 predicted 4058
2 SASI_Mm01_00150944 predicted 1955
3 SASI_Mm01_00150945 predicted 2480
4 SASI_Mm01_00150949 predicted 1561
5 SASI_Mm02_00345922 predicted 888
6 SASI_Mm01_00150951 predicted 2541
7 SASI_Mm01_00150952 predicted 1937
8 SASI_Mm02_00345923 predicted 1162
9 SASI_Mm02_00345924 predicted 6771
10 SASI_Mm02_00345925 predicted 2081
11 SASI_Mm01_00150943 predicted 2746
12 SASI_Mm01_00150946 predicted 6466
13 SASI_Mm01_00150947 predicted 2429
14 SASI_Mm01_00150948 predicted 7234
15 SASI_Mm01_00150950 predicted 2120
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175238
VALIDATED
RIF1 MISSION shRNA Bacterial Glycerol Stock
RAP1 interacting factor homolog (yeast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175238.3-7171s1c1
Sequence:CCGGGCTCTTCAACTGGACTCAGAACTCGAGTTCTGAGTCCAGTTGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175238.3-5995s1c1
Sequence:CCGGGCCCAGATGAGCACTGAAATTCTCGAGAATTTCAGTGCTCATCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175238.3-1735s1c1
Sequence:CCGGCCAGCATATCAGGTTGCTAATCTCGAGATTAGCAACCTGATATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175238.3-726s1c1
Sequence:CCGGGCACCTTATGACTACTAAATTCTCGAGAATTTAGTAGTCATAAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175238.3-2590s1c1
Sequence:CCGGCCCTCTATGATCCGAGAAATACTCGAGTATTTCTCGGATCATAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175238
VALIDATED
RIF1 MISSION shRNA shRNA Plasmid DNA
RAP1 interacting factor homolog (yeast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175238.3-7171s1c1
Sequence:CCGGGCTCTTCAACTGGACTCAGAACTCGAGTTCTGAGTCCAGTTGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175238.3-5995s1c1
Sequence:CCGGGCCCAGATGAGCACTGAAATTCTCGAGAATTTCAGTGCTCATCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175238.3-1735s1c1
Sequence:CCGGCCAGCATATCAGGTTGCTAATCTCGAGATTAGCAACCTGATATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175238.3-726s1c1
Sequence:CCGGGCACCTTATGACTACTAAATTCTCGAGAATTTAGTAGTCATAAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175238.3-2590s1c1
Sequence:CCGGCCCTCTATGATCCGAGAAATACTCGAGTATTTCTCGGATCATAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175238
VALIDATED
RIF1 MISSION shRNA Lentiviral Transduction Particles
RAP1 interacting factor homolog (yeast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175238.3-7171s1c1
Sequence:CCGGGCTCTTCAACTGGACTCAGAACTCGAGTTCTGAGTCCAGTTGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175238.3-5995s1c1
Sequence:CCGGGCCCAGATGAGCACTGAAATTCTCGAGAATTTCAGTGCTCATCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175238.3-1735s1c1
Sequence:CCGGCCAGCATATCAGGTTGCTAATCTCGAGATTAGCAACCTGATATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175238.3-726s1c1
Sequence:CCGGGCACCTTATGACTACTAAATTCTCGAGAATTTAGTAGTCATAAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175238.3-2590s1c1
Sequence:CCGGCCCTCTATGATCCGAGAAATACTCGAGTATTTCTCGGATCATAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018151
RIF1 MISSION shRNA Bacterial Glycerol Stock
RAP1 interacting factor homolog (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018151.1-3982s1c1
Sequence:CCGGCCACCTGGTTTGCTTAATCAACTCGAGTTGATTAAGCAAACCAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018151.1-3067s1c1
Sequence:CCGGGCAGCCAAACTGAAACTTGAACTCGAGTTCAAGTTTCAGTTTGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018151.1-458s1c1
Sequence:CCGGCGCATTCTGCTGTTGTTGATTCTCGAGAATCAACAACAGCAGAATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018151.1-6150s1c1
Sequence:CCGGGCCTGATGAAGCTGAAACAAACTCGAGTTTGTTTCAGCTTCATCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018151.1-1498s1c1
Sequence:CCGGGCTATCTGGAAGGAGCTAATTCTCGAGAATTAGCTCCTTCCAGATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018151.1-6668s1c1
Sequence:CCGGGCTCTATTGTTAGGTCCCATTCTCGAGAATGGGACCTAACAATAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018151.1-1699s1c1
Sequence:CCGGCCAGCATATCAGGTTGCTAATCTCGAGATTAGCAACCTGATATGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018151.1-5590s1c1
Sequence:CCGGCCGTGTTTAGGAGACTCGAAACTCGAGTTTCGAGTCTCCTAAACACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018151.3-8102s1c1
Sequence:CCGGTTTCAACTTCTGGCGGTTAAACTCGAGTTTAACCGCCAGAAGTTGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018151.3-8203s1c1
Sequence:CCGGTCTTATGAGACGTATAGTATTCTCGAGAATACTATACGTCTCATAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018151
RIF1 MISSION shRNA shRNA Plasmid DNA
RAP1 interacting factor homolog (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018151.1-3982s1c1
Sequence:CCGGCCACCTGGTTTGCTTAATCAACTCGAGTTGATTAAGCAAACCAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018151.1-3067s1c1
Sequence:CCGGGCAGCCAAACTGAAACTTGAACTCGAGTTCAAGTTTCAGTTTGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018151.1-458s1c1
Sequence:CCGGCGCATTCTGCTGTTGTTGATTCTCGAGAATCAACAACAGCAGAATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018151.1-6150s1c1
Sequence:CCGGGCCTGATGAAGCTGAAACAAACTCGAGTTTGTTTCAGCTTCATCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018151.1-1498s1c1
Sequence:CCGGGCTATCTGGAAGGAGCTAATTCTCGAGAATTAGCTCCTTCCAGATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018151.1-6668s1c1
Sequence:CCGGGCTCTATTGTTAGGTCCCATTCTCGAGAATGGGACCTAACAATAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018151.1-1699s1c1
Sequence:CCGGCCAGCATATCAGGTTGCTAATCTCGAGATTAGCAACCTGATATGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018151.1-5590s1c1
Sequence:CCGGCCGTGTTTAGGAGACTCGAAACTCGAGTTTCGAGTCTCCTAAACACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018151.3-8102s1c1
Sequence:CCGGTTTCAACTTCTGGCGGTTAAACTCGAGTTTAACCGCCAGAAGTTGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018151.3-8203s1c1
Sequence:CCGGTCTTATGAGACGTATAGTATTCTCGAGAATACTATACGTCTCATAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018151
RIF1 MISSION shRNA Lentiviral Transduction Particles
RAP1 interacting factor homolog (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018151.1-3982s1c1
Sequence:CCGGCCACCTGGTTTGCTTAATCAACTCGAGTTGATTAAGCAAACCAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018151.1-3067s1c1
Sequence:CCGGGCAGCCAAACTGAAACTTGAACTCGAGTTCAAGTTTCAGTTTGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018151.1-458s1c1
Sequence:CCGGCGCATTCTGCTGTTGTTGATTCTCGAGAATCAACAACAGCAGAATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018151.1-6150s1c1
Sequence:CCGGGCCTGATGAAGCTGAAACAAACTCGAGTTTGTTTCAGCTTCATCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018151.1-1498s1c1
Sequence:CCGGGCTATCTGGAAGGAGCTAATTCTCGAGAATTAGCTCCTTCCAGATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018151.1-6668s1c1
Sequence:CCGGGCTCTATTGTTAGGTCCCATTCTCGAGAATGGGACCTAACAATAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018151.1-1699s1c1
Sequence:CCGGCCAGCATATCAGGTTGCTAATCTCGAGATTAGCAACCTGATATGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018151.1-5590s1c1
Sequence:CCGGCCGTGTTTAGGAGACTCGAAACTCGAGTTTCGAGTCTCCTAAACACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018151.3-8102s1c1
Sequence:CCGGTTTCAACTTCTGGCGGTTAAACTCGAGTTTAACCGCCAGAAGTTGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018151.3-8203s1c1
Sequence:CCGGTCTTATGAGACGTATAGTATTCTCGAGAATACTATACGTCTCATAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)