EMAIL THIS PAGE TO A FRIEND

RIIAD1

regulatory subunit of type II PKA R-subunit (RIIa) domain containing 1

62 Gene Product Result for
Synonyms: C1orf230 NCRNA00166
UniProtKB ID: A6NNX1
Gene ID:
Mouse(66353) regulatory subunit of type II PKA R-subunit (RIIa) domain containing 1
Rat(100270669) regulatory subunit of type II PKA R-subunit (RIIa) domain containing 1
cow(767988) regulatory subunit of type II PKA R-subunit (RIIa) domain containing 1
sheep(101118746) regulatory subunit of type II PKA R-subunit (RIIa) domain containing 1
naked mole-rat(101698121) regulatory subunit of type II PKA R-subunit (RIIa) domain containing 1
domestic guinea pig(101788871) regulatory subunit of type II PKA R-subunit (RIIa) domain containing 1
dog(100294631) regulatory subunit of type II PKA R-subunit (RIIa) domain containing 1
domestic cat(101080648) regulatory subunit of type II PKA R-subunit (RIIa) domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025506 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025506 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025506 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001144956 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001144956 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001144956 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU073621 MISSION® esiRNA targeting mouse Riiad1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001721352 Rosetta Predictions human pricing
XM_371311 Rosetta Predictions human pricing
XM_930413 Rosetta Predictions human pricing
XM_937062 Rosetta Predictions human pricing
NM_025506 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00442360 predicted 1519
2 SASI_Hs02_00442361 predicted 1323
3 SASI_Hs02_00442362 predicted 1325
4 SASI_Hs02_00442363 predicted 1527
5 SASI_Hs02_00442364 predicted 1386
6 SASI_Hs02_00442365 predicted 1286
7 SASI_Hs02_00442366 predicted 1433
8 SASI_Hs02_00442367 predicted 1336
9 SASI_Hs02_00442368 predicted 1455
10 SASI_Hs02_00442369 predicted 1456
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248936 predicted 1525
2 SASI_Hs02_00479304 predicted 1316
3 SASI_Hs02_00479305 predicted 1323
4 SASI_Hs01_00248937 predicted 1528
5 SASI_Hs02_00479306 predicted 1383
6 SASI_Hs02_00479307 predicted 1293
7 SASI_Hs02_00479308 predicted 1441
8 SASI_Hs02_00479309 predicted 1339
9 SASI_Hs02_00479310 predicted 1453
10 SASI_Hs02_00479311 predicted 1448
11 SASI_Hs01_00248938 predicted 418
12 SASI_Hs01_00248939 predicted 423
13 SASI_Hs01_00248940 predicted 401
14 SASI_Hs01_00248941 predicted 382
15 SASI_Hs01_00248942 predicted 423
16 SASI_Hs01_00248943 predicted 387
17 SASI_Hs01_00248944 predicted 392
18 SASI_Hs01_00248945 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262461 predicted 341
2 SASI_Hs01_00262462 predicted 162
3 SASI_Hs01_00262463 predicted 377
4 SASI_Hs01_00262464 predicted 142
5 SASI_Hs01_00262465 predicted 375
6 SASI_Hs01_00262466 predicted 147
7 SASI_Hs01_00262467 predicted 68
8 SASI_Hs01_00262468 predicted 339
9 SASI_Hs01_00262469 predicted 121
10 SASI_Hs01_00262470 predicted 142
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_937062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482416 predicted 1519
2 SASI_Hs02_00482417 predicted 1324
3 SASI_Hs02_00482418 predicted 1327
4 SASI_Hs02_00482419 predicted 1533
5 SASI_Hs02_00482420 predicted 1385
6 SASI_Hs02_00482421 predicted 1292
7 SASI_Hs02_00482422 predicted 1435
8 SASI_Hs02_00482423 predicted 1340
9 SASI_Hs02_00482424 predicted 1453
10 SASI_Hs02_00482425 predicted 1453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089676 predicted 317
2 SASI_Mm01_00089677 predicted 264
3 SASI_Mm01_00089678 predicted 371
4 SASI_Mm01_00089679 predicted 231
5 SASI_Mm02_00328387 predicted 313
6 SASI_Mm01_00089680 predicted 400
7 SASI_Mm01_00089681 predicted 355
8 SASI_Mm01_00089682 predicted 360
9 SASI_Mm01_00089683 predicted 235
10 SASI_Mm01_00089684 predicted 384
11 SASI_Mm01_00089685 predicted 253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025506
RIIAD1 MISSION shRNA Bacterial Glycerol Stock
regulatory subunit of type II PKA R-subunit (RIIa) domain containing 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025506.2-443s21c1
Sequence:CCGGAGAGAAGAAAGGAACCTAATTCTCGAGAATTAGGTTCCTTTCTTCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-386s1c1
Sequence:CCGGGCTGCACACTATTTCACGGATCTCGAGATCCGTGAAATAGTGTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.2-458s1c1
Sequence:CCGGCTAATTAGCAAAGCCACAATGCTCGAGCATTGTGGCTTTGCTAATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-340s1c1
Sequence:CCGGCTTCAGAGAAATGTTTCTGAACTCGAGTTCAGAAACATTTCTCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-430s1c1
Sequence:CCGGCATGCAGCTAATTAAAGAGAACTCGAGTTCTCTTTAATTAGCTGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025506.2-292s21c1
Sequence:CCGGAGTACTTGAGAACCCACAAAGCTCGAGCTTTGTGGGTTCTCAAGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-250s1c1
Sequence:CCGGGCAGTTGCGAGATTTCAAGATCTCGAGATCTTGAAATCTCGCAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-132s1c1
Sequence:CCGGGAAGAGAAGAAGCCTGGATTTCTCGAGAAATCCAGGCTTCTTCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-433s1c1
Sequence:CCGGGCAGCTAATTAAAGAGAAGAACTCGAGTTCTTCTCTTTAATTAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-365s1c1
Sequence:CCGGCCGGACAACATTCTTGAATTTCTCGAGAAATTCAAGAATGTTGTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-148s1c1
Sequence:CCGGGATTTCTTTCGGCAAGCACAACTCGAGTTGTGCTTGCCGAAAGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-310s1c1
Sequence:CCGGCAAAGAGGTGTCTCTGCTCATCTCGAGATGAGCAGAGACACCTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025506.2-320s21c1
Sequence:CCGGTCTGCTCATCAGCGGCTTCTTCTCGAGAAGAAGCCGCTGATGAGCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025506
RIIAD1 MISSION shRNA shRNA Plasmid DNA
regulatory subunit of type II PKA R-subunit (RIIa) domain containing 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025506.2-443s21c1
Sequence:CCGGAGAGAAGAAAGGAACCTAATTCTCGAGAATTAGGTTCCTTTCTTCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-386s1c1
Sequence:CCGGGCTGCACACTATTTCACGGATCTCGAGATCCGTGAAATAGTGTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.2-458s1c1
Sequence:CCGGCTAATTAGCAAAGCCACAATGCTCGAGCATTGTGGCTTTGCTAATTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-340s1c1
Sequence:CCGGCTTCAGAGAAATGTTTCTGAACTCGAGTTCAGAAACATTTCTCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-430s1c1
Sequence:CCGGCATGCAGCTAATTAAAGAGAACTCGAGTTCTCTTTAATTAGCTGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025506.2-292s21c1
Sequence:CCGGAGTACTTGAGAACCCACAAAGCTCGAGCTTTGTGGGTTCTCAAGTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-250s1c1
Sequence:CCGGGCAGTTGCGAGATTTCAAGATCTCGAGATCTTGAAATCTCGCAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-132s1c1
Sequence:CCGGGAAGAGAAGAAGCCTGGATTTCTCGAGAAATCCAGGCTTCTTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-433s1c1
Sequence:CCGGGCAGCTAATTAAAGAGAAGAACTCGAGTTCTTCTCTTTAATTAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-365s1c1
Sequence:CCGGCCGGACAACATTCTTGAATTTCTCGAGAAATTCAAGAATGTTGTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-148s1c1
Sequence:CCGGGATTTCTTTCGGCAAGCACAACTCGAGTTGTGCTTGCCGAAAGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-310s1c1
Sequence:CCGGCAAAGAGGTGTCTCTGCTCATCTCGAGATGAGCAGAGACACCTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025506.2-320s21c1
Sequence:CCGGTCTGCTCATCAGCGGCTTCTTCTCGAGAAGAAGCCGCTGATGAGCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025506
RIIAD1 MISSION shRNA Lentiviral Transduction Particles
regulatory subunit of type II PKA R-subunit (RIIa) domain containing 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025506.2-443s21c1
Sequence:CCGGAGAGAAGAAAGGAACCTAATTCTCGAGAATTAGGTTCCTTTCTTCTCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000182297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-386s1c1
Sequence:CCGGGCTGCACACTATTTCACGGATCTCGAGATCCGTGAAATAGTGTGCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000216498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.2-458s1c1
Sequence:CCGGCTAATTAGCAAAGCCACAATGCTCGAGCATTGTGGCTTTGCTAATTAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000177083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-340s1c1
Sequence:CCGGCTTCAGAGAAATGTTTCTGAACTCGAGTTCAGAAACATTTCTCTGAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000197455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-430s1c1
Sequence:CCGGCATGCAGCTAATTAAAGAGAACTCGAGTTCTCTTTAATTAGCTGCATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000435794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025506.2-292s21c1
Sequence:CCGGAGTACTTGAGAACCCACAAAGCTCGAGCTTTGTGGGTTCTCAAGTACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000181893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-250s1c1
Sequence:CCGGGCAGTTGCGAGATTTCAAGATCTCGAGATCTTGAAATCTCGCAACTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000181562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-132s1c1
Sequence:CCGGGAAGAGAAGAAGCCTGGATTTCTCGAGAAATCCAGGCTTCTTCTCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000176963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-433s1c1
Sequence:CCGGGCAGCTAATTAAAGAGAAGAACTCGAGTTCTTCTCTTTAATTAGCTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000177645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-365s1c1
Sequence:CCGGCCGGACAACATTCTTGAATTTCTCGAGAAATTCAAGAATGTTGTCCGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000181652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-148s1c1
Sequence:CCGGGATTTCTTTCGGCAAGCACAACTCGAGTTGTGCTTGCCGAAAGAAATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000200218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025506.1-310s1c1
Sequence:CCGGCAAAGAGGTGTCTCTGCTCATCTCGAGATGAGCAGAGACACCTCTTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000419623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025506.2-320s21c1
Sequence:CCGGTCTGCTCATCAGCGGCTTCTTCTCGAGAAGAAGCCGCTGATGAGCAGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001144956
RIIAD1 MISSION shRNA Bacterial Glycerol Stock
regulatory subunit of type II PKA R-subunit (RIIa) domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144956.1-224s21c1
Sequence:CCGGCAAGACTTCCCAACAAGATTCCTCGAGGAATCTTGTTGGGAAGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144956.1-261s21c1
Sequence:CCGGAGACAAGAAAGCGGCTTAATTCTCGAGAATTAAGCCGCTTTCTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144956.1-291s21c1
Sequence:CCGGATGATGCTCAGCTGTTGGGAGCTCGAGCTCCCAACAGCTGAGCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144956.1-110s21c1
Sequence:CCGGAGTACCTAAGGACCCACAAAGCTCGAGCTTTGTGGGTCCTTAGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144956.1-80s21c1
Sequence:CCGGTCAAGATTCAGACTCGGATTGCTCGAGCAATCCGAGTCTGAATCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001144956
RIIAD1 MISSION shRNA shRNA Plasmid DNA
regulatory subunit of type II PKA R-subunit (RIIa) domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144956.1-224s21c1
Sequence:CCGGCAAGACTTCCCAACAAGATTCCTCGAGGAATCTTGTTGGGAAGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144956.1-261s21c1
Sequence:CCGGAGACAAGAAAGCGGCTTAATTCTCGAGAATTAAGCCGCTTTCTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144956.1-291s21c1
Sequence:CCGGATGATGCTCAGCTGTTGGGAGCTCGAGCTCCCAACAGCTGAGCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144956.1-110s21c1
Sequence:CCGGAGTACCTAAGGACCCACAAAGCTCGAGCTTTGTGGGTCCTTAGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144956.1-80s21c1
Sequence:CCGGTCAAGATTCAGACTCGGATTGCTCGAGCAATCCGAGTCTGAATCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001144956
RIIAD1 MISSION shRNA Lentiviral Transduction Particles
regulatory subunit of type II PKA R-subunit (RIIa) domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144956.1-224s21c1
Sequence:CCGGCAAGACTTCCCAACAAGATTCCTCGAGGAATCTTGTTGGGAAGTCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000336972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144956.1-261s21c1
Sequence:CCGGAGACAAGAAAGCGGCTTAATTCTCGAGAATTAAGCCGCTTTCTTGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000337048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144956.1-291s21c1
Sequence:CCGGATGATGCTCAGCTGTTGGGAGCTCGAGCTCCCAACAGCTGAGCATCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000337045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144956.1-110s21c1
Sequence:CCGGAGTACCTAAGGACCCACAAAGCTCGAGCTTTGTGGGTCCTTAGGTACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000337044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144956.1-80s21c1
Sequence:CCGGTCAAGATTCAGACTCGGATTGCTCGAGCAATCCGAGTCTGAATCTTGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???