EMAIL THIS PAGE TO A FRIEND

RIMBP2

RIMS binding protein 2

263 Gene Product Result for
Synonyms: RBP2 RIM-BP2
UniProtKB ID: O15034, Q96ID2
Gene ID:
Mouse(231760) RIMS binding protein 2
Rat(266780) RIMS binding protein 2
cow(527119) RIMS binding protein 2
sheep(101113794) RIMS binding protein 2
naked mole-rat(101709351) RIMS binding protein 2
Zebrafish(563166) RIMS binding protein 2
Horse(100060373) RIMS binding protein 2
chicken(374105) RIMS binding protein 2
domestic cat(101099153) RIMS binding protein 2
dog(486231) RIMS binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081388 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081388 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081388 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015347 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015347 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015347 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015347 Rosetta Predictions human pricing
XM_001064396 Rosetta Predictions rat pricing
XM_001073313 Rosetta Predictions rat pricing
XM_001073349 Rosetta Predictions rat pricing
XM_001073377 Rosetta Predictions rat pricing
XM_001073406 Rosetta Predictions rat pricing
XM_341071 Rosetta Predictions rat pricing
NM_001081388 Rosetta Predictions mouse pricing
XM_132396 Rosetta Predictions mouse pricing
XM_895913 Rosetta Predictions mouse pricing
XM_895934 Rosetta Predictions mouse pricing
XM_974193 Rosetta Predictions mouse pricing
XM_974230 Rosetta Predictions mouse pricing
XM_974314 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064281 predicted 618
2 SASI_Hs01_00064282 predicted 1501
3 SASI_Hs01_00064283 predicted 2288
4 SASI_Hs01_00064284 predicted 1464
5 SASI_Hs01_00064285 predicted 1073
6 SASI_Hs01_00064286 predicted 2784
7 SASI_Hs01_00064287 predicted 1203
8 SASI_Hs01_00064288 predicted 3022
9 SASI_Hs01_00064289 predicted 2882
10 SASI_Hs01_00064290 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064396 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310294 predicted 1036
2 SASI_Rn02_00310295 predicted 1296
3 SASI_Rn02_00310296 predicted 334
4 SASI_Rn02_00310297 predicted 1233
5 SASI_Rn02_00310298 predicted 1560
6 SASI_Rn02_00310299 predicted 1548
7 SASI_Rn02_00310300 predicted 2719
8 SASI_Rn02_00310301 predicted 290
9 SASI_Rn02_00310302 predicted 1245
10 SASI_Rn02_00310303 predicted 3179
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073313 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342342 predicted 1392
2 SASI_Rn02_00342343 predicted 1655
3 SASI_Rn02_00342344 predicted 691
4 SASI_Rn02_00342345 predicted 1592
5 SASI_Rn02_00342346 predicted 1916
6 SASI_Rn02_00342347 predicted 1905
7 SASI_Rn02_00342348 predicted 2850
8 SASI_Rn02_00342349 predicted 2339
9 SASI_Rn02_00342350 predicted 647
10 SASI_Rn02_00342351 predicted 1605
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342475 predicted 1031
2 SASI_Rn02_00342476 predicted 1288
3 SASI_Rn02_00342477 predicted 901
4 SASI_Rn02_00342478 predicted 334
5 SASI_Rn02_00342479 predicted 1236
6 SASI_Rn02_00342480 predicted 1564
7 SASI_Rn02_00342481 predicted 1545
8 SASI_Rn02_00342482 predicted 2715
9 SASI_Rn02_00342483 predicted 1559
10 SASI_Rn02_00342484 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073377 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342575 predicted 1028
2 SASI_Rn02_00342576 predicted 1290
3 SASI_Rn02_00342577 predicted 327
4 SASI_Rn02_00342578 predicted 1230
5 SASI_Rn02_00342579 predicted 1566
6 SASI_Rn02_00342580 predicted 1549
7 SASI_Rn02_00342581 predicted 2711
8 SASI_Rn02_00342582 predicted 290
9 SASI_Rn02_00342583 predicted 1239
10 SASI_Rn02_00342584 predicted 3181
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073406 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342721 predicted 1114
2 SASI_Rn02_00342722 predicted 1373
3 SASI_Rn02_00342723 predicted 411
4 SASI_Rn02_00342724 predicted 1309
5 SASI_Rn02_00342725 predicted 1639
6 SASI_Rn02_00342726 predicted 1625
7 SASI_Rn02_00342727 predicted 2796
8 SASI_Rn02_00342728 predicted 367
9 SASI_Rn02_00342729 predicted 1323
10 SASI_Rn02_00342730 predicted 3262
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392319 predicted 1390
2 SASI_Rn02_00392320 predicted 1656
3 SASI_Rn02_00392321 predicted 687
4 SASI_Rn02_00392322 predicted 1594
5 SASI_Rn02_00392323 predicted 1918
6 SASI_Rn02_00392324 predicted 1906
7 SASI_Rn02_00392325 predicted 2852
8 SASI_Rn02_00392326 predicted 2331
9 SASI_Rn02_00392327 predicted 647
10 SASI_Rn02_00392328 predicted 1606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081388 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297911 predicted 1008
2 SASI_Mm02_00297912 predicted 3586
3 SASI_Mm02_00297913 predicted 935
4 SASI_Mm02_00297914 predicted 1906
5 SASI_Mm02_00297915 predicted 1706
6 SASI_Mm02_00297916 predicted 3541
7 SASI_Mm02_00297917 predicted 1577
8 SASI_Mm02_00297918 predicted 3177
9 SASI_Mm02_00297919 predicted 3560
10 SASI_Mm02_00297920 predicted 3524
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269619 predicted 3000
2 SASI_Mm01_00269620 predicted 609
3 SASI_Mm01_00269621 predicted 3186
4 SASI_Mm01_00269622 predicted 549
5 SASI_Mm01_00269623 predicted 1510
6 SASI_Mm01_00269624 predicted 1316
7 SASI_Mm01_00269625 predicted 3151
8 SASI_Mm01_00269626 predicted 1179
9 SASI_Mm01_00269627 predicted 2790
10 SASI_Mm01_00269628 predicted 3165
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895913 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270331 predicted 2733
2 SASI_Mm01_00270332 predicted 333
3 SASI_Mm01_00270333 predicted 2911
4 SASI_Mm01_00270334 predicted 270
5 SASI_Mm01_00270335 predicted 1233
6 SASI_Mm01_00270336 predicted 1036
7 SASI_Mm01_00270337 predicted 2875
8 SASI_Mm01_00270338 predicted 901
9 SASI_Mm01_00270339 predicted 2516
10 SASI_Mm01_00270340 predicted 2895
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895934 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229839 predicted 3183
2 SASI_Mm01_00229840 predicted 1006
3 SASI_Mm01_00229841 predicted 3366
4 SASI_Mm01_00229842 predicted 945
5 SASI_Mm01_00229843 predicted 1907
6 SASI_Mm01_00229844 predicted 1707
7 SASI_Mm01_00229845 predicted 3327
8 SASI_Mm01_00229846 predicted 1580
9 SASI_Mm01_00229847 predicted 2958
10 SASI_Mm01_00229848 predicted 3342
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_974193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223166 predicted 3160
2 SASI_Mm01_00223167 predicted 776
3 SASI_Mm01_00223168 predicted 3353
4 SASI_Mm01_00223169 predicted 708
5 SASI_Mm01_00223170 predicted 1671
6 SASI_Mm01_00223171 predicted 1470
7 SASI_Mm01_00223172 predicted 3311
8 SASI_Mm01_00223173 predicted 1339
9 SASI_Mm01_00223174 predicted 2948
10 SASI_Mm01_00223175 predicted 3329
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_974230 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252690 predicted 3096
2 SASI_Mm01_00252691 predicted 710
3 SASI_Mm01_00252692 predicted 3283
4 SASI_Mm01_00252693 predicted 634
5 SASI_Mm01_00252694 predicted 1612
6 SASI_Mm01_00252695 predicted 1402
7 SASI_Mm01_00252696 predicted 3248
8 SASI_Mm01_00252697 predicted 1273
9 SASI_Mm01_00252698 predicted 2876
10 SASI_Mm01_00252699 predicted 3258
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_974314 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259147 predicted 3402
2 SASI_Mm01_00259148 predicted 1006
3 SASI_Mm01_00259149 predicted 3594
4 SASI_Mm01_00259150 predicted 946
5 SASI_Mm01_00259151 predicted 1908
6 SASI_Mm01_00259152 predicted 1714
7 SASI_Mm01_00259153 predicted 3548
8 SASI_Mm01_00259154 predicted 1575
9 SASI_Mm01_00259155 predicted 3183
10 SASI_Mm01_00259156 predicted 3563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081388
RIMBP2 MISSION shRNA Bacterial Glycerol Stock
RIMS binding protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081388.1-1988s21c1
Sequence:CCGGCTTCAACCTCAGGCCTAATATCTCGAGATATTAGGCCTGAGGTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081388.1-3824s21c1
Sequence:GTACCGGTGTTCATTTCACACCCTAATCCTCGAGGATTAGGGTGTGAAATGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081388.1-3321s21c1
Sequence:GTACCGGGGACAGATCATCAAGGTATATCTCGAGATATACCTTGATGATCTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081388.1-3916s21c1
Sequence:CCGGCGGACAGCACGGTAGTCTTAACTCGAGTTAAGACTACCGTGCTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081388.1-1644s21c1
Sequence:CCGGGGCACCGTGAGCAGTTATAATCTCGAGATTATAACTGCTCACGGTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081388
RIMBP2 MISSION shRNA shRNA Plasmid DNA
RIMS binding protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081388.1-1988s21c1
Sequence:CCGGCTTCAACCTCAGGCCTAATATCTCGAGATATTAGGCCTGAGGTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081388.1-3824s21c1
Sequence:GTACCGGTGTTCATTTCACACCCTAATCCTCGAGGATTAGGGTGTGAAATGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081388.1-3321s21c1
Sequence:GTACCGGGGACAGATCATCAAGGTATATCTCGAGATATACCTTGATGATCTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081388.1-3916s21c1
Sequence:CCGGCGGACAGCACGGTAGTCTTAACTCGAGTTAAGACTACCGTGCTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081388.1-1644s21c1
Sequence:CCGGGGCACCGTGAGCAGTTATAATCTCGAGATTATAACTGCTCACGGTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081388
RIMBP2 MISSION shRNA Lentiviral Transduction Particles
RIMS binding protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081388.1-1988s21c1
Sequence:CCGGCTTCAACCTCAGGCCTAATATCTCGAGATATTAGGCCTGAGGTTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081388.1-3824s21c1
Sequence:GTACCGGTGTTCATTTCACACCCTAATCCTCGAGGATTAGGGTGTGAAATGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081388.1-3321s21c1
Sequence:GTACCGGGGACAGATCATCAAGGTATATCTCGAGATATACCTTGATGATCTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081388.1-3916s21c1
Sequence:CCGGCGGACAGCACGGTAGTCTTAACTCGAGTTAAGACTACCGTGCTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081388.1-1644s21c1
Sequence:CCGGGGCACCGTGAGCAGTTATAATCTCGAGATTATAACTGCTCACGGTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015347
RIMBP2 MISSION shRNA Bacterial Glycerol Stock
RIMS binding protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155646    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015347.2-3324s1c1
Sequence:CCGGCAGATTACAAACCCGGAGGAACTCGAGTTCCTCCGGGTTTGTAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015347.2-1323s1c1
Sequence:CCGGGCTCTGCGATCGGTGAATATACTCGAGTATATTCACCGATCGCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015347.2-2791s1c1
Sequence:CCGGGCCATTAGCAAGTTCTGGAGTCTCGAGACTCCAGAACTTGCTAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015347.2-1729s1c1
Sequence:CCGGGCAGGATCAGAACTTCATCAACTCGAGTTGATGAAGTTCTGATCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015347.2-3614s1c1
Sequence:CCGGCCTGCTACAAGAGATGACTTTCTCGAGAAAGTCATCTCTTGTAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015347.2-1442s1c1
Sequence:CCGGGACATGGAGAATGAACGGAATCTCGAGATTCCGTTCATTCTCCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015347.2-3161s1c1
Sequence:CCGGGACTTCCTGAAAGGCTCTGAACTCGAGTTCAGAGCCTTTCAGGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015347.2-2781s1c1
Sequence:CCGGCCCAATCAAAGCCATTAGCAACTCGAGTTGCTAATGGCTTTGATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015347.2-1465s1c1
Sequence:CCGGCAATACCTCCAAGCAGAGATACTCGAGTATCTCTGCTTGGAGGTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015347
RIMBP2 MISSION shRNA shRNA Plasmid DNA
RIMS binding protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155646    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015347.2-3324s1c1
Sequence:CCGGCAGATTACAAACCCGGAGGAACTCGAGTTCCTCCGGGTTTGTAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015347.2-1323s1c1
Sequence:CCGGGCTCTGCGATCGGTGAATATACTCGAGTATATTCACCGATCGCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015347.2-2791s1c1
Sequence:CCGGGCCATTAGCAAGTTCTGGAGTCTCGAGACTCCAGAACTTGCTAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015347.2-1729s1c1
Sequence:CCGGGCAGGATCAGAACTTCATCAACTCGAGTTGATGAAGTTCTGATCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015347.2-3614s1c1
Sequence:CCGGCCTGCTACAAGAGATGACTTTCTCGAGAAAGTCATCTCTTGTAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015347.2-1442s1c1
Sequence:CCGGGACATGGAGAATGAACGGAATCTCGAGATTCCGTTCATTCTCCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015347.2-3161s1c1
Sequence:CCGGGACTTCCTGAAAGGCTCTGAACTCGAGTTCAGAGCCTTTCAGGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015347.2-2781s1c1
Sequence:CCGGCCCAATCAAAGCCATTAGCAACTCGAGTTGCTAATGGCTTTGATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015347.2-1465s1c1
Sequence:CCGGCAATACCTCCAAGCAGAGATACTCGAGTATCTCTGCTTGGAGGTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015347
RIMBP2 MISSION shRNA Lentiviral Transduction Particles
RIMS binding protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155646    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015347.2-3324s1c1
Sequence:CCGGCAGATTACAAACCCGGAGGAACTCGAGTTCCTCCGGGTTTGTAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015347.2-1323s1c1
Sequence:CCGGGCTCTGCGATCGGTGAATATACTCGAGTATATTCACCGATCGCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015347.2-2791s1c1
Sequence:CCGGGCCATTAGCAAGTTCTGGAGTCTCGAGACTCCAGAACTTGCTAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015347.2-1729s1c1
Sequence:CCGGGCAGGATCAGAACTTCATCAACTCGAGTTGATGAAGTTCTGATCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015347.2-3614s1c1
Sequence:CCGGCCTGCTACAAGAGATGACTTTCTCGAGAAAGTCATCTCTTGTAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015347.2-1442s1c1
Sequence:CCGGGACATGGAGAATGAACGGAATCTCGAGATTCCGTTCATTCTCCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015347.2-3161s1c1
Sequence:CCGGGACTTCCTGAAAGGCTCTGAACTCGAGTTCAGAGCCTTTCAGGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015347.2-2781s1c1
Sequence:CCGGCCCAATCAAAGCCATTAGCAACTCGAGTTGCTAATGGCTTTGATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015347.2-1465s1c1
Sequence:CCGGCAATACCTCCAAGCAGAGATACTCGAGTATCTCTGCTTGGAGGTATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)