EMAIL THIS PAGE TO A FRIEND

RIMBP3

RIMS binding protein 3

92 Gene Product Result for
Synonyms: RIM-BP3 RIM-BP3.1 RIM-BP3.A RIMBP3.1 RIMBP3A
UniProtKB ID: Q9UFD9, Q8IYP7, Q9BY94, Q9UFQ5
Gene ID:
Mouse(239731) RIMS binding protein 3
Rat(303785) RIMS binding protein 3
domestic cat(101091053) RIMS binding protein 3
Horse(100146960) RIMS binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033338 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033338 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033338 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015672 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU215141 MISSION® esiRNA esiRNA targeting mouse Rimbp3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015672 Rosetta Predictions human pricing
XM_371429 Rosetta Predictions human pricing
XM_001064091 Rosetta Predictions rat pricing
XM_221302 Rosetta Predictions rat pricing
NM_001033338 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348304 predicted 4194
2 SASI_Hs02_00348305 predicted 4599
3 SASI_Hs02_00348306 predicted 3969
4 SASI_Hs02_00348307 predicted 3853
5 SASI_Hs02_00348308 predicted 3550
6 SASI_Hs02_00348309 predicted 4198
7 SASI_Hs02_00348310 predicted 3265
8 SASI_Hs02_00348311 predicted 2647
9 SASI_Hs02_00348312 predicted 1829
10 SASI_Hs02_00348313 predicted 2555
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258479 predicted 4834
2 SASI_Hs01_00258480 predicted 3487
3 SASI_Hs01_00258481 predicted 4953
4 SASI_Hs01_00258482 predicted 3370
5 SASI_Hs01_00258483 predicted 3480
6 SASI_Hs01_00258484 predicted 4828
7 SASI_Hs01_00258485 predicted 3071
8 SASI_Hs01_00258486 predicted 2776
9 SASI_Hs01_00258487 predicted 3509
10 SASI_Hs01_00258488 predicted 2789
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064091 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309309 predicted 3393
2 SASI_Rn02_00309310 predicted 4569
3 SASI_Rn02_00309311 predicted 4577
4 SASI_Rn02_00309312 predicted 2132
5 SASI_Rn02_00309313 predicted 590
6 SASI_Rn02_00309314 predicted 837
7 SASI_Rn02_00309315 predicted 4750
8 SASI_Rn02_00309316 predicted 3049
9 SASI_Rn02_00309317 predicted 2639
10 SASI_Rn02_00309318 predicted 4545
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221302 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379984 predicted 3393
2 SASI_Rn02_00379985 predicted 4562
3 SASI_Rn02_00379986 predicted 4581
4 SASI_Rn02_00379987 predicted 2137
5 SASI_Rn02_00379988 predicted 588
6 SASI_Rn02_00379989 predicted 835
7 SASI_Rn02_00379990 predicted 4747
8 SASI_Rn02_00379991 predicted 3050
9 SASI_Rn02_00379992 predicted 2639
10 SASI_Rn02_00379993 predicted 4542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033338 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112682 predicted 3246
2 SASI_Mm01_00112683 predicted 3388
3 SASI_Mm01_00112684 predicted 1696
4 SASI_Mm01_00112685 predicted 1169
5 SASI_Mm01_00112686 predicted 1447
6 SASI_Mm01_00112688 predicted 5311
7 SASI_Mm01_00112689 predicted 3219
8 SASI_Mm01_00112690 predicted 5122
9 SASI_Mm01_00112691 predicted 4001
10 SASI_Mm02_00288592 predicted 4823
11 SASI_Mm01_00112687 predicted 2473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033338
RIMBP3 MISSION shRNA Bacterial Glycerol Stock
RIMS binding protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033338.3-5309s21c1
Sequence:CCGGATGATAAGGGATTCTACTATGCTCGAGCATAGTAGAATCCCTTATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033338.3-3221s21c1
Sequence:CCGGCCAACTTAGTGGAACCGATTTCTCGAGAAATCGGTTCCACTAAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033338.3-4062s21c1
Sequence:CCGGGGATTCAGTACCGGCTCAAATCTCGAGATTTGAGCCGGTACTGAATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033338.3-1721s21c1
Sequence:CCGGACTTGCATCTGCGGCGTAAAGCTCGAGCTTTACGCCGCAGATGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033338.3-5663s21c1
Sequence:CCGGGGATAACCATGATGGGTATTACTCGAGTAATACCCATCATGGTTATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033338
RIMBP3 MISSION shRNA shRNA Plasmid DNA
RIMS binding protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033338.3-5309s21c1
Sequence:CCGGATGATAAGGGATTCTACTATGCTCGAGCATAGTAGAATCCCTTATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033338.3-3221s21c1
Sequence:CCGGCCAACTTAGTGGAACCGATTTCTCGAGAAATCGGTTCCACTAAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033338.3-4062s21c1
Sequence:CCGGGGATTCAGTACCGGCTCAAATCTCGAGATTTGAGCCGGTACTGAATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033338.3-1721s21c1
Sequence:CCGGACTTGCATCTGCGGCGTAAAGCTCGAGCTTTACGCCGCAGATGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033338.3-5663s21c1
Sequence:CCGGGGATAACCATGATGGGTATTACTCGAGTAATACCCATCATGGTTATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033338
RIMBP3 MISSION shRNA Lentiviral Transduction Particles
RIMS binding protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033338.3-5309s21c1
Sequence:CCGGATGATAAGGGATTCTACTATGCTCGAGCATAGTAGAATCCCTTATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033338.3-3221s21c1
Sequence:CCGGCCAACTTAGTGGAACCGATTTCTCGAGAAATCGGTTCCACTAAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033338.3-4062s21c1
Sequence:CCGGGGATTCAGTACCGGCTCAAATCTCGAGATTTGAGCCGGTACTGAATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033338.3-1721s21c1
Sequence:CCGGACTTGCATCTGCGGCGTAAAGCTCGAGCTTTACGCCGCAGATGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033338.3-5663s21c1
Sequence:CCGGGGATAACCATGATGGGTATTACTCGAGTAATACCCATCATGGTTATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015672
RIMBP3 MISSION shRNA Bacterial Glycerol Stock
RIMS binding protein 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015672.1-5311s21c1
Sequence:CCGGTGGATGACCAAGGATTCTATTCTCGAGAATAGAATCCTTGGTCATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015672.1-3262s21c1
Sequence:CCGGTGGAGGAAGACAGCTTATTATCTCGAGATAATAAGCTGTCTTCCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015672.1-2619s21c1
Sequence:CCGGATGCCGGAGTCCCAAGTTAAACTCGAGTTTAACTTGGGACTCCGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015672.1-5584s21c1
Sequence:CCGGGGACTTAAGCCTGAGTTATTTCTCGAGAAATAACTCAGGCTTAAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015672.1-3003s21c1
Sequence:CCGGCAGTATAACTACAACCCATTTCTCGAGAAATGGGTTGTAGTTATACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015672
RIMBP3 MISSION shRNA shRNA Plasmid DNA
RIMS binding protein 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015672.1-5311s21c1
Sequence:CCGGTGGATGACCAAGGATTCTATTCTCGAGAATAGAATCCTTGGTCATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015672.1-3262s21c1
Sequence:CCGGTGGAGGAAGACAGCTTATTATCTCGAGATAATAAGCTGTCTTCCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015672.1-2619s21c1
Sequence:CCGGATGCCGGAGTCCCAAGTTAAACTCGAGTTTAACTTGGGACTCCGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015672.1-5584s21c1
Sequence:CCGGGGACTTAAGCCTGAGTTATTTCTCGAGAAATAACTCAGGCTTAAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015672.1-3003s21c1
Sequence:CCGGCAGTATAACTACAACCCATTTCTCGAGAAATGGGTTGTAGTTATACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015672
RIMBP3 MISSION shRNA Lentiviral Transduction Particles
RIMS binding protein 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015672.1-5311s21c1
Sequence:CCGGTGGATGACCAAGGATTCTATTCTCGAGAATAGAATCCTTGGTCATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015672.1-3262s21c1
Sequence:CCGGTGGAGGAAGACAGCTTATTATCTCGAGATAATAAGCTGTCTTCCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015672.1-2619s21c1
Sequence:CCGGATGCCGGAGTCCCAAGTTAAACTCGAGTTTAACTTGGGACTCCGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015672.1-5584s21c1
Sequence:CCGGGGACTTAAGCCTGAGTTATTTCTCGAGAAATAACTCAGGCTTAAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015672.1-3003s21c1
Sequence:CCGGCAGTATAACTACAACCCATTTCTCGAGAAATGGGTTGTAGTTATACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)