EMAIL THIS PAGE TO A FRIEND

RIMKLA

ribosomal modification protein rimK-like family member A

88 Gene Product Result for
Synonyms: FAM80A NAAGS NAAGS-II
UniProtKB ID: Q8IXN7, Q5VUS5
Gene ID:
Mouse(194237) ribosomal modification protein rimK-like family member A
Rat(313553) ribosomal modification protein rimK-like family member A
Zebrafish(447815) ribosomal modification protein rimK-like family member A
domestic cat(101099388) ribosomal modification protein rimK-like family member A
dog(482445) ribosomal modification protein rimK-like family member A
naked mole-rat(101721728) ribosomal modification protein rimK-like family member A
Domestic Rabbit(100356205) ribosomal modification protein rimK-like family member A
domestic guinea pig(100713055) ribosomal modification protein rimK-like family member A
cow(507323) ribosomal modification protein rimK-like family member A
sheep(101104941) ribosomal modification protein rimK-like family member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177572 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177572 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177572 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173642 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000241 MISSION® esiRNA esiRNA targeting human FAM80A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173642 Rosetta Predictions human pricing
XM_001073980 Rosetta Predictions rat pricing
XM_233459 Rosetta Predictions rat pricing
NM_177572 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368538 predicted 1379
2 SASI_Hs02_00368539 predicted 1558
3 SASI_Hs02_00368540 predicted 1437
4 SASI_Hs02_00368541 predicted 904
5 SASI_Hs01_00125018 predicted 1020
6 SASI_Hs02_00368542 predicted 1524
7 SASI_Hs02_00368543 predicted 1385
8 SASI_Hs01_00125023 predicted 977
9 SASI_Hs01_00125024 predicted 466
10 SASI_Hs02_00368544 predicted 1453
11 SASI_Hs01_00125016 predicted 369
12 SASI_Hs01_00125017 predicted 1253
13 SASI_Hs01_00125019 predicted 378
14 SASI_Hs01_00125020 predicted 1210
15 SASI_Hs01_00125021 predicted 825
16 SASI_Hs01_00125022 predicted 1077
17 SASI_Hs01_00125025 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073980 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344591 predicted 1049
2 SASI_Rn02_00344592 predicted 1697
3 SASI_Rn02_00344593 predicted 1422
4 SASI_Rn02_00344594 predicted 1266
5 SASI_Rn02_00344595 predicted 1039
6 SASI_Rn02_00344596 predicted 1620
7 SASI_Rn02_00344597 predicted 1560
8 SASI_Rn02_00344598 predicted 1787
9 SASI_Rn02_00344599 predicted 1683
10 SASI_Rn02_00344600 predicted 1221
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233459 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00185456 predicted 319
2 SASI_Rn01_00185457 predicted 411
3 SASI_Rn01_00185458 predicted 229
4 SASI_Rn01_00185459 predicted 406
5 SASI_Rn01_00185460 predicted 308
6 SASI_Rn01_00185461 predicted 218
7 SASI_Rn01_00185462 predicted 395
8 SASI_Rn01_00185463 predicted 322
9 SASI_Rn01_00185464 predicted 381
10 SASI_Rn01_00185465 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177572 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131669 predicted 796
2 SASI_Mm01_00131670 predicted 1507
3 SASI_Mm01_00131671 predicted 1099
4 SASI_Mm01_00131672 predicted 1480
5 SASI_Mm02_00347726 predicted 1347
6 SASI_Mm01_00131675 predicted 689
7 SASI_Mm01_00131676 predicted 1303
8 SASI_Mm01_00131677 predicted 1003
9 SASI_Mm01_00131678 predicted 1094
10 SASI_Mm02_00347727 predicted 1353
11 SASI_Mm01_00131673 predicted 1414
12 SASI_Mm01_00131674 predicted 1493
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177572
RIMKLA MISSION shRNA Bacterial Glycerol Stock
ribosomal modification protein rimK-like family member A
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177572.3-1243s21c1
Sequence:CCGGCAAGCCTGGTTACAGCATTAACTCGAGTTAATGCTGTAACCAGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177572.3-419s21c1
Sequence:CCGGACCGTCCTCAAAGCATCTTAACTCGAGTTAAGATGCTTTGAGGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177572.3-2584s21c1
Sequence:CCGGCAATGCTCTTTGGCTATTAATCTCGAGATTAATAGCCAAAGAGCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177572.3-2584s1c1
Sequence:CCGGCAATGCTCTTTGGCTATTAATCTCGAGATTAATAGCCAAAGAGCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177572.3-432s1c1
Sequence:CCGGCATCTTAAACTGCATCAACAACTCGAGTTGTTGATGCAGTTTAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177572.3-324s21c1
Sequence:CCGGCGTGGTGGTTGTTCGAGTATCCTCGAGGATACTCGAACAACCACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177572.3-968s21c1
Sequence:CCGGTCGACCAGGCATGCAACTTAGCTCGAGCTAAGTTGCATGCCTGGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177572
RIMKLA MISSION shRNA shRNA Plasmid DNA
ribosomal modification protein rimK-like family member A
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177572.3-1243s21c1
Sequence:CCGGCAAGCCTGGTTACAGCATTAACTCGAGTTAATGCTGTAACCAGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177572.3-419s21c1
Sequence:CCGGACCGTCCTCAAAGCATCTTAACTCGAGTTAAGATGCTTTGAGGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177572.3-2584s21c1
Sequence:CCGGCAATGCTCTTTGGCTATTAATCTCGAGATTAATAGCCAAAGAGCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177572.3-2584s1c1
Sequence:CCGGCAATGCTCTTTGGCTATTAATCTCGAGATTAATAGCCAAAGAGCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177572.3-432s1c1
Sequence:CCGGCATCTTAAACTGCATCAACAACTCGAGTTGTTGATGCAGTTTAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177572.3-324s21c1
Sequence:CCGGCGTGGTGGTTGTTCGAGTATCCTCGAGGATACTCGAACAACCACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177572.3-968s21c1
Sequence:CCGGTCGACCAGGCATGCAACTTAGCTCGAGCTAAGTTGCATGCCTGGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177572
RIMKLA MISSION shRNA Lentiviral Transduction Particles
ribosomal modification protein rimK-like family member A
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177572.3-1243s21c1
Sequence:CCGGCAAGCCTGGTTACAGCATTAACTCGAGTTAATGCTGTAACCAGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177572.3-419s21c1
Sequence:CCGGACCGTCCTCAAAGCATCTTAACTCGAGTTAAGATGCTTTGAGGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177572.3-2584s21c1
Sequence:CCGGCAATGCTCTTTGGCTATTAATCTCGAGATTAATAGCCAAAGAGCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177572.3-2584s1c1
Sequence:CCGGCAATGCTCTTTGGCTATTAATCTCGAGATTAATAGCCAAAGAGCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177572.3-432s1c1
Sequence:CCGGCATCTTAAACTGCATCAACAACTCGAGTTGTTGATGCAGTTTAAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177572.3-324s21c1
Sequence:CCGGCGTGGTGGTTGTTCGAGTATCCTCGAGGATACTCGAACAACCACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177572.3-968s21c1
Sequence:CCGGTCGACCAGGCATGCAACTTAGCTCGAGCTAAGTTGCATGCCTGGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173642
RIMKLA MISSION shRNA Bacterial Glycerol Stock
ribosomal modification protein rimK-like family member A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173642.1-754s1c1
Sequence:CCGGCAGGTCATAGGCTCTATGCTTCTCGAGAAGCATAGAGCCTATGACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173642.1-1278s1c1
Sequence:CCGGCAGGATTGCTTCTGAGTTAAACTCGAGTTTAACTCAGAAGCAATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173642.1-1254s1c1
Sequence:CCGGCGAACCTGGCTACAACATTAACTCGAGTTAATGTTGTAGCCAGGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173642.1-850s1c1
Sequence:CCGGCAAGGCAAGCAGTTGGCTATTCTCGAGAATAGCCAACTGCTTGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173642.1-1323s1c1
Sequence:CCGGGCAGCATTTAAACCAAATCCTCTCGAGAGGATTTGGTTTAAATGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173642.1-1341s1c1
Sequence:CCGGCCTACTGCTTCCCTAGTAGTTCTCGAGAACTACTAGGGAAGCAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173642
RIMKLA MISSION shRNA shRNA Plasmid DNA
ribosomal modification protein rimK-like family member A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173642.1-754s1c1
Sequence:CCGGCAGGTCATAGGCTCTATGCTTCTCGAGAAGCATAGAGCCTATGACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173642.1-1278s1c1
Sequence:CCGGCAGGATTGCTTCTGAGTTAAACTCGAGTTTAACTCAGAAGCAATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173642.1-1254s1c1
Sequence:CCGGCGAACCTGGCTACAACATTAACTCGAGTTAATGTTGTAGCCAGGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173642.1-850s1c1
Sequence:CCGGCAAGGCAAGCAGTTGGCTATTCTCGAGAATAGCCAACTGCTTGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173642.1-1323s1c1
Sequence:CCGGGCAGCATTTAAACCAAATCCTCTCGAGAGGATTTGGTTTAAATGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173642.1-1341s1c1
Sequence:CCGGCCTACTGCTTCCCTAGTAGTTCTCGAGAACTACTAGGGAAGCAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173642
RIMKLA MISSION shRNA Lentiviral Transduction Particles
ribosomal modification protein rimK-like family member A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173642.1-754s1c1
Sequence:CCGGCAGGTCATAGGCTCTATGCTTCTCGAGAAGCATAGAGCCTATGACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173642.1-1278s1c1
Sequence:CCGGCAGGATTGCTTCTGAGTTAAACTCGAGTTTAACTCAGAAGCAATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173642.1-1254s1c1
Sequence:CCGGCGAACCTGGCTACAACATTAACTCGAGTTAATGTTGTAGCCAGGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173642.1-850s1c1
Sequence:CCGGCAAGGCAAGCAGTTGGCTATTCTCGAGAATAGCCAACTGCTTGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173642.1-1323s1c1
Sequence:CCGGGCAGCATTTAAACCAAATCCTCTCGAGAGGATTTGGTTTAAATGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173642.1-1341s1c1
Sequence:CCGGCCTACTGCTTCCCTAGTAGTTCTCGAGAACTACTAGGGAAGCAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)