EMAIL THIS PAGE TO A FRIEND

RIMS3

regulating synaptic membrane exocytosis 3

261 Gene Product Result for
Synonyms: NIM3 RIM3
UniProtKB ID: Q9UJD0, D3DPV8, Q92511
Gene ID:
Mouse(242662) regulating synaptic membrane exocytosis 3
Rat(65025) regulating synaptic membrane exocytosis 3
Zebrafish(563414) regulating synaptic membrane exocytosis 3
domestic cat(101099062) regulating synaptic membrane exocytosis 3
chicken(428226) regulating synaptic membrane exocytosis 3
dog(607486) regulating synaptic membrane exocytosis 3
naked mole-rat(101712272) regulating synaptic membrane exocytosis 3
domestic guinea pig(100714524) regulating synaptic membrane exocytosis 3
cow(519929) regulating synaptic membrane exocytosis 3
sheep(101102435) regulating synaptic membrane exocytosis 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500455 Anti-Rim3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV34736 Anti-RIMS3 antibody produced in rabbit IgG fraction of antiserum horse, zebrafish, human, mouse, bovine, guinea pig, rabbit, canine, rat
immunohistochemistry, western blot pricing
HPA055285 Anti-RIMS3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014747 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014747 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014747 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182929 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182929 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182929 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014747 Rosetta Predictions human pricing
NM_022931 Rosetta Predictions rat pricing
NM_182929 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194163 predicted 935
2 SASI_Hs01_00194164 predicted 931
3 SASI_Hs01_00194165 predicted 871
4 SASI_Hs01_00194166 predicted 1034
5 SASI_Hs01_00194167 predicted 856
6 SASI_Hs01_00194168 predicted 641
7 SASI_Hs01_00194169 predicted 1049
8 SASI_Hs01_00194170 predicted 631
9 SASI_Hs01_00194171 predicted 689
10 SASI_Hs01_00194172 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022931 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070737 predicted 1238
2 SASI_Rn01_00070739 predicted 863
3 SASI_Rn01_00070741 predicted 1009
4 SASI_Rn02_00263625 predicted 912
5 SASI_Rn01_00070742 predicted 820
6 SASI_Rn01_00070743 predicted 1167
7 SASI_Rn01_00070744 predicted 835
8 SASI_Rn01_00070745 predicted 761
9 SASI_Rn01_00070746 predicted 1180
10 SASI_Rn02_00263626 predicted 1094
11 SASI_Rn01_00070738 predicted 619
12 SASI_Rn01_00070740 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171689 predicted 724
2 SASI_Mm01_00171690 predicted 569
3 SASI_Mm01_00171691 predicted 461
4 SASI_Mm01_00171693 predicted 316
5 SASI_Mm02_00349984 predicted 395
6 SASI_Mm01_00171694 predicted 742
7 SASI_Mm01_00171695 predicted 719
8 SASI_Mm01_00171696 predicted 654
9 SASI_Mm01_00171697 predicted 751
10 SASI_Mm02_00349985 predicted 568
11 SASI_Mm01_00171692 predicted 468
12 SASI_Mm01_00171698 predicted 227
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014747
VALIDATED
RIMS3 MISSION shRNA Bacterial Glycerol Stock
regulating synaptic membrane exocytosis 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014747.2-859s21c1
Sequence:CCGGTGAAAGCCAGTTCAGCGATTTCTCGAGAAATCGCTGAACTGGCTTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014747.2-1033s21c1
Sequence:CCGGATCCCTCCCAGCCACCTATATCTCGAGATATAGGTGGCTGGGAGGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063703    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_014747.1-3104s1c1
Sequence:CCGGCCTCCATTCATAACCAAAGTTCTCGAGAACTTTGGTTATGAATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063705    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_014747.1-990s1c1
Sequence:CCGGAGGTGGAAGTGATTGAAGCTCCTCGAGGAGCTTCAATCACTTCCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063707    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014747.1-1113s1c1
Sequence:CCGGTGACCAAGAAGACCTGTGATCCTCGAGGATCACAGGTCTTCTTGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014747.1-1093s1c1
Sequence:CCGGGGCCAAGAAGAAGACAAAGATCTCGAGATCTTTGTCTTCTTCTTGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063704    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014747.1-989s1c1
Sequence:CCGGGAGGTGGAAGTGATTGAAGCTCTCGAGAGCTTCAATCACTTCCACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014747
VALIDATED
RIMS3 MISSION shRNA shRNA Plasmid DNA
regulating synaptic membrane exocytosis 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014747.2-859s21c1
Sequence:CCGGTGAAAGCCAGTTCAGCGATTTCTCGAGAAATCGCTGAACTGGCTTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014747.2-1033s21c1
Sequence:CCGGATCCCTCCCAGCCACCTATATCTCGAGATATAGGTGGCTGGGAGGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063703    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_014747.1-3104s1c1
Sequence:CCGGCCTCCATTCATAACCAAAGTTCTCGAGAACTTTGGTTATGAATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063705    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_014747.1-990s1c1
Sequence:CCGGAGGTGGAAGTGATTGAAGCTCCTCGAGGAGCTTCAATCACTTCCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063707    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014747.1-1113s1c1
Sequence:CCGGTGACCAAGAAGACCTGTGATCCTCGAGGATCACAGGTCTTCTTGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014747.1-1093s1c1
Sequence:CCGGGGCCAAGAAGAAGACAAAGATCTCGAGATCTTTGTCTTCTTCTTGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063704    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014747.1-989s1c1
Sequence:CCGGGAGGTGGAAGTGATTGAAGCTCTCGAGAGCTTCAATCACTTCCACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014747
VALIDATED
RIMS3 MISSION shRNA Lentiviral Transduction Particles
regulating synaptic membrane exocytosis 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014747.2-859s21c1
Sequence:CCGGTGAAAGCCAGTTCAGCGATTTCTCGAGAAATCGCTGAACTGGCTTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014747.2-1033s21c1
Sequence:CCGGATCCCTCCCAGCCACCTATATCTCGAGATATAGGTGGCTGGGAGGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063703    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_014747.1-3104s1c1
Sequence:CCGGCCTCCATTCATAACCAAAGTTCTCGAGAACTTTGGTTATGAATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063705    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_014747.1-990s1c1
Sequence:CCGGAGGTGGAAGTGATTGAAGCTCCTCGAGGAGCTTCAATCACTTCCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063707    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014747.1-1113s1c1
Sequence:CCGGTGACCAAGAAGACCTGTGATCCTCGAGGATCACAGGTCTTCTTGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014747.1-1093s1c1
Sequence:CCGGGGCCAAGAAGAAGACAAAGATCTCGAGATCTTTGTCTTCTTCTTGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063704    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014747.1-989s1c1
Sequence:CCGGGAGGTGGAAGTGATTGAAGCTCTCGAGAGCTTCAATCACTTCCACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182929
RIMS3 MISSION shRNA Bacterial Glycerol Stock
regulating synaptic membrane exocytosis 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182929.2-148s21c1
Sequence:CCGGGGTGCCAAGATGGTAGCTATCCTCGAGGATAGCTACCATCTTGGCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182929.2-564s21c1
Sequence:CCGGCCTCCCAGCCACCTATATCAACTCGAGTTGATATAGGTGGCTGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182929.2-757s21c1
Sequence:CCGGATGGGTATGGCCCAGATCATGCTCGAGCATGATCTGGGCCATACCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182929.2-347s21c1
Sequence:CCGGGCTCCGAGGGCACGTTTATTTCTCGAGAAATAAACGTGCCCTCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182929.2-807s21c1
Sequence:CCGGCACCGGCTGGTACAAACTCTTCTCGAGAAGAGTTTGTACCAGCCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182929.1-225s1c1
Sequence:CCGGCACCAAGAAGCTTCGAAGCAACTCGAGTTGCTTCGAAGCTTCTTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182929.1-388s1c1
Sequence:CCGGGAAAGCCAGTTCAGTGACTTTCTCGAGAAAGTCACTGAACTGGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182929.1-41s1c1
Sequence:CCGGCCAGGAATGTAGTAAGGAGTTCTCGAGAACTCCTTACTACATTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182929
RIMS3 MISSION shRNA shRNA Plasmid DNA
regulating synaptic membrane exocytosis 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182929.2-148s21c1
Sequence:CCGGGGTGCCAAGATGGTAGCTATCCTCGAGGATAGCTACCATCTTGGCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182929.2-564s21c1
Sequence:CCGGCCTCCCAGCCACCTATATCAACTCGAGTTGATATAGGTGGCTGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182929.2-757s21c1
Sequence:CCGGATGGGTATGGCCCAGATCATGCTCGAGCATGATCTGGGCCATACCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182929.2-347s21c1
Sequence:CCGGGCTCCGAGGGCACGTTTATTTCTCGAGAAATAAACGTGCCCTCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182929.2-807s21c1
Sequence:CCGGCACCGGCTGGTACAAACTCTTCTCGAGAAGAGTTTGTACCAGCCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182929.1-225s1c1
Sequence:CCGGCACCAAGAAGCTTCGAAGCAACTCGAGTTGCTTCGAAGCTTCTTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182929.1-388s1c1
Sequence:CCGGGAAAGCCAGTTCAGTGACTTTCTCGAGAAAGTCACTGAACTGGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182929.1-41s1c1
Sequence:CCGGCCAGGAATGTAGTAAGGAGTTCTCGAGAACTCCTTACTACATTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182929
RIMS3 MISSION shRNA Lentiviral Transduction Particles
regulating synaptic membrane exocytosis 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182929.2-148s21c1
Sequence:CCGGGGTGCCAAGATGGTAGCTATCCTCGAGGATAGCTACCATCTTGGCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182929.2-564s21c1
Sequence:CCGGCCTCCCAGCCACCTATATCAACTCGAGTTGATATAGGTGGCTGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182929.2-757s21c1
Sequence:CCGGATGGGTATGGCCCAGATCATGCTCGAGCATGATCTGGGCCATACCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182929.2-347s21c1
Sequence:CCGGGCTCCGAGGGCACGTTTATTTCTCGAGAAATAAACGTGCCCTCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182929.2-807s21c1
Sequence:CCGGCACCGGCTGGTACAAACTCTTCTCGAGAAGAGTTTGTACCAGCCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182929.1-225s1c1
Sequence:CCGGCACCAAGAAGCTTCGAAGCAACTCGAGTTGCTTCGAAGCTTCTTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182929.1-388s1c1
Sequence:CCGGGAAAGCCAGTTCAGTGACTTTCTCGAGAAAGTCACTGAACTGGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182929.1-41s1c1
Sequence:CCGGCCAGGAATGTAGTAAGGAGTTCTCGAGAACTCCTTACTACATTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)