EMAIL THIS PAGE TO A FRIEND

RIMS4

regulating synaptic membrane exocytosis 4

165 Gene Product Result for
Synonyms: C20orf190 RIM 4 RIM-4 RIM4 RIM4-gamma RIM4gamma
UniProtKB ID: Q9H426, A4FU94, E1P613, Q3MI44, Q5JWT7
Gene ID:
Mouse(241770) regulating synaptic membrane exocytosis 4
Rat(266976) regulating synaptic membrane exocytosis 4
cow(539592) regulating synaptic membrane exocytosis 4
sheep(101107123) regulating synaptic membrane exocytosis 4
domestic guinea pig(100714842) regulating synaptic membrane exocytosis 4
naked mole-rat(101706073) regulating synaptic membrane exocytosis 4
chicken(428142) regulating synaptic membrane exocytosis 4
dog(100684964) regulating synaptic membrane exocytosis 4
domestic cat(101090180) regulating synaptic membrane exocytosis 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA060928 Anti-RIMS4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4500479 Anti-RIMS4 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183023 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183023 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183023 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182970 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182970 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182970 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU046641 MISSION® esiRNA esiRNA targeting mouse Rims4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182970 Rosetta Predictions human pricing
NM_170666 Rosetta Predictions rat pricing
NM_183023 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238205 predicted 996
2 SASI_Hs01_00238206 predicted 1071
3 SASI_Hs01_00238207 predicted 520
4 SASI_Hs01_00238209 predicted 302
5 SASI_Hs01_00238210 predicted 221
6 SASI_Hs02_00371124 predicted 607
7 SASI_Hs01_00238212 predicted 1202
8 SASI_Hs01_00238213 predicted 790
9 SASI_Hs01_00238214 predicted 418
10 SASI_Hs02_00371125 predicted 532
11 SASI_Hs01_00238208 predicted 1196
12 SASI_Hs01_00238211 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170666 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095187 predicted 307
2 SASI_Rn01_00095188 predicted 504
3 SASI_Rn01_00095190 predicted 237
4 SASI_Rn01_00095191 predicted 449
5 SASI_Rn01_00095192 predicted 568
6 SASI_Rn02_00269044 predicted 346
7 SASI_Rn01_00095193 predicted 519
8 SASI_Rn01_00095194 predicted 206
9 SASI_Rn01_00095195 predicted 523
10 SASI_Rn01_00095196 predicted 529
11 SASI_Rn01_00095189 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183023 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078751 predicted 303
2 SASI_Mm01_00078753 predicted 432
3 SASI_Mm02_00350023 predicted 223
4 SASI_Mm01_00078754 predicted 233
5 SASI_Mm01_00078755 predicted 514
6 SASI_Mm01_00078756 predicted 519
7 SASI_Mm01_00078757 predicted 246
8 SASI_Mm01_00078758 predicted 450
9 SASI_Mm01_00078759 predicted 529
10 SASI_Mm01_00078760 predicted 261
11 SASI_Mm01_00078752 predicted 512
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183023
RIMS4 MISSION shRNA Bacterial Glycerol Stock
regulating synaptic membrane exocytosis 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183023.1-442s21c1
Sequence:CCGGACACTGCCAGCTGCCTATATCCTCGAGGATATAGGCAGCTGGCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183023.1-296s21c1
Sequence:CCGGGTATGGGACCAGCACAGTTTGCTCGAGCAAACTGTGCTGGTCCCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183023.1-576s21c1
Sequence:CCGGGGGCAAAGTCCTGCAGGTAATCTCGAGATTACCTGCAGGACTTTGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183023.1-227s21c1
Sequence:CCGGCAGAGGGCAACCTTAACTATGCTCGAGCATAGTTAAGGTTGCCCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183023.1-542s21c1
Sequence:CCGGACAACCAGGTGCTTCTGTTTCCTCGAGGAAACAGAAGCACCTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183023
RIMS4 MISSION shRNA shRNA Plasmid DNA
regulating synaptic membrane exocytosis 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183023.1-442s21c1
Sequence:CCGGACACTGCCAGCTGCCTATATCCTCGAGGATATAGGCAGCTGGCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183023.1-296s21c1
Sequence:CCGGGTATGGGACCAGCACAGTTTGCTCGAGCAAACTGTGCTGGTCCCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183023.1-576s21c1
Sequence:CCGGGGGCAAAGTCCTGCAGGTAATCTCGAGATTACCTGCAGGACTTTGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183023.1-227s21c1
Sequence:CCGGCAGAGGGCAACCTTAACTATGCTCGAGCATAGTTAAGGTTGCCCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183023.1-542s21c1
Sequence:CCGGACAACCAGGTGCTTCTGTTTCCTCGAGGAAACAGAAGCACCTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183023
RIMS4 MISSION shRNA Lentiviral Transduction Particles
regulating synaptic membrane exocytosis 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183023.1-442s21c1
Sequence:CCGGACACTGCCAGCTGCCTATATCCTCGAGGATATAGGCAGCTGGCAGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183023.1-296s21c1
Sequence:CCGGGTATGGGACCAGCACAGTTTGCTCGAGCAAACTGTGCTGGTCCCATACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183023.1-576s21c1
Sequence:CCGGGGGCAAAGTCCTGCAGGTAATCTCGAGATTACCTGCAGGACTTTGCCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183023.1-227s21c1
Sequence:CCGGCAGAGGGCAACCTTAACTATGCTCGAGCATAGTTAAGGTTGCCCTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183023.1-542s21c1
Sequence:CCGGACAACCAGGTGCTTCTGTTTCCTCGAGGAAACAGAAGCACCTGGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182970
RIMS4 MISSION shRNA Bacterial Glycerol Stock
regulating synaptic membrane exocytosis 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182970.2-2573s1c1
Sequence:CCGGCGGAAATTCTTCCCTTCCCTTCTCGAGAAGGGAAGGGAAGAATTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182970.2-480s1c1
Sequence:CCGGGAATGGCATCTGCATTGCCAACTCGAGTTGGCAATGCAGATGCCATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182970.2-236s1c1
Sequence:CCGGACCTTAACTATGGAGGAGTTTCTCGAGAAACTCCTCCATAGTTAAGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182970.2-381s1c1
Sequence:CCGGCGGTCAGTTGGAGGTGGACATCTCGAGATGTCCACCTCCAACTGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182970.2-54s1c1
Sequence:CCGGCATCTACTTCCCGTGCATGAACTCGAGTTCATGCACGGGAAGTAGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182970.2-524s21c1
Sequence:CCGGAGTCGCTGGACCCACTGTATACTCGAGTATACAGTGGGTCCAGCGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182970.2-618s21c1
Sequence:CCGGGATGGAGCGGAAGCAGTTCATCTCGAGATGAACTGCTTCCGCTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182970
RIMS4 MISSION shRNA shRNA Plasmid DNA
regulating synaptic membrane exocytosis 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182970.2-2573s1c1
Sequence:CCGGCGGAAATTCTTCCCTTCCCTTCTCGAGAAGGGAAGGGAAGAATTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182970.2-480s1c1
Sequence:CCGGGAATGGCATCTGCATTGCCAACTCGAGTTGGCAATGCAGATGCCATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182970.2-236s1c1
Sequence:CCGGACCTTAACTATGGAGGAGTTTCTCGAGAAACTCCTCCATAGTTAAGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182970.2-381s1c1
Sequence:CCGGCGGTCAGTTGGAGGTGGACATCTCGAGATGTCCACCTCCAACTGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182970.2-54s1c1
Sequence:CCGGCATCTACTTCCCGTGCATGAACTCGAGTTCATGCACGGGAAGTAGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182970.2-524s21c1
Sequence:CCGGAGTCGCTGGACCCACTGTATACTCGAGTATACAGTGGGTCCAGCGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182970.2-618s21c1
Sequence:CCGGGATGGAGCGGAAGCAGTTCATCTCGAGATGAACTGCTTCCGCTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182970
RIMS4 MISSION shRNA Lentiviral Transduction Particles
regulating synaptic membrane exocytosis 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182970.2-2573s1c1
Sequence:CCGGCGGAAATTCTTCCCTTCCCTTCTCGAGAAGGGAAGGGAAGAATTTCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182970.2-480s1c1
Sequence:CCGGGAATGGCATCTGCATTGCCAACTCGAGTTGGCAATGCAGATGCCATTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182970.2-236s1c1
Sequence:CCGGACCTTAACTATGGAGGAGTTTCTCGAGAAACTCCTCCATAGTTAAGGTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182970.2-381s1c1
Sequence:CCGGCGGTCAGTTGGAGGTGGACATCTCGAGATGTCCACCTCCAACTGACCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182970.2-54s1c1
Sequence:CCGGCATCTACTTCCCGTGCATGAACTCGAGTTCATGCACGGGAAGTAGATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182970.2-524s21c1
Sequence:CCGGAGTCGCTGGACCCACTGTATACTCGAGTATACAGTGGGTCCAGCGACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182970.2-618s21c1
Sequence:CCGGGATGGAGCGGAAGCAGTTCATCTCGAGATGAACTGCTTCCGCTCCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)