EMAIL THIS PAGE TO A FRIEND

RIN1

Ras and Rab interactor 1

51 Gene Product Result for
UniProtKB ID: Q13671, O15010, Q00427, Q96CC8
Gene ID:
Mouse(225870) Ras and Rab interactor 1
Rat(207119) Ras and Rab interactor 1
Thale Cress(832293) RPM1-interacting protein TIP49a
Horse(100058267) Ras and Rab interactor 1
domestic cat(101084059) Ras and Rab interactor 1
dog(611928) Ras and Rab interactor 1
naked mole-rat(101726644) Ras and Rab interactor 1
domestic guinea pig(100728511) Ras and Rab interactor 1
cow(509295) Ras and Rab interactor 1
sheep(101113711) Ras and Rab interactor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004292 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004292 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004292 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145495 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145495 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145495 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004292 Rosetta Predictions human pricing
NM_139038 Rosetta Predictions rat pricing
NM_145495 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165191 predicted 1847
2 SASI_Hs01_00165192 predicted 2072
3 SASI_Hs01_00165193 predicted 650
4 SASI_Hs01_00165194 predicted 393
5 SASI_Hs01_00165195 predicted 2018
6 SASI_Hs01_00165196 predicted 535
7 SASI_Hs01_00165197 predicted 2073
8 SASI_Hs01_00165198 predicted 2004
9 SASI_Hs01_00165199 predicted 1392
10 SASI_Hs01_00165200 predicted 1394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139038 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044157 predicted 1869
2 SASI_Rn01_00044158 predicted 251
3 SASI_Rn02_00268416 predicted 1877
4 SASI_Rn02_00268417 predicted 2212
5 SASI_Rn01_00044161 predicted 1301
6 SASI_Rn01_00044162 predicted 1505
7 SASI_Rn01_00044163 predicted 643
8 SASI_Rn01_00044164 predicted 778
9 SASI_Rn01_00044165 predicted 934
10 SASI_Rn01_00044166 predicted 478
11 SASI_Rn01_00044159 predicted 1930
12 SASI_Rn01_00044160 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145495 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081927 predicted 1673
2 SASI_Mm01_00081928 predicted 412
3 SASI_Mm01_00081929 predicted 1689
4 SASI_Mm01_00081930 predicted 891
5 SASI_Mm01_00081931 predicted 1681
6 SASI_Mm01_00081932 predicted 827
7 SASI_Mm01_00081933 predicted 412
8 SASI_Mm01_00081934 predicted 1483
9 SASI_Mm01_00081935 predicted 228
10 SASI_Mm01_00081936 predicted 1968
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004292
RIN1 MISSION shRNA Bacterial Glycerol Stock
Ras and Rab interactor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004292.2-2520s21c1
Sequence:CCGGGAGCCTGCTGAGAAATCCTTTCTCGAGAAAGGATTTCTCAGCAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004292.2-406s21c1
Sequence:CCGGGCGGAAATCTAACACCCGCCACTCGAGTGGCGGGTGTTAGATTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004292.2-227s21c1
Sequence:CCGGCCACTGTATGACGTGCCCAATCTCGAGATTGGGCACGTCATACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004292.1-2520s1c1
Sequence:CCGGGAGCCTGCTGAGAAATCCTTTCTCGAGAAAGGATTTCTCAGCAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004292.1-227s1c1
Sequence:CCGGCCACTGTATGACGTGCCCAATCTCGAGATTGGGCACGTCATACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004292.1-1424s1c1
Sequence:CCGGGAGAAGTCATTGCATTGCTCTCTCGAGAGAGCAATGCAATGACTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004292.1-2378s1c1
Sequence:CCGGCAGTCTGAGACAACTGCTGAACTCGAGTTCAGCAGTTGTCTCAGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004292.2-2378s21c1
Sequence:CCGGCAGTCTGAGACAACTGCTGAACTCGAGTTCAGCAGTTGTCTCAGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004292.1-406s1c2
Sequence:CCGGGCGGAAATCTAACACCCGCCACTCGAGTGGCGGGTGTTAGATTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004292.2-1424s21c1
Sequence:CCGGGAGAAGTCATTGCATTGCTCTCTCGAGAGAGCAATGCAATGACTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004292
RIN1 MISSION shRNA shRNA Plasmid DNA
Ras and Rab interactor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004292.2-2520s21c1
Sequence:CCGGGAGCCTGCTGAGAAATCCTTTCTCGAGAAAGGATTTCTCAGCAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004292.2-406s21c1
Sequence:CCGGGCGGAAATCTAACACCCGCCACTCGAGTGGCGGGTGTTAGATTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004292.2-227s21c1
Sequence:CCGGCCACTGTATGACGTGCCCAATCTCGAGATTGGGCACGTCATACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004292.1-2520s1c1
Sequence:CCGGGAGCCTGCTGAGAAATCCTTTCTCGAGAAAGGATTTCTCAGCAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004292.1-227s1c1
Sequence:CCGGCCACTGTATGACGTGCCCAATCTCGAGATTGGGCACGTCATACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004292.1-1424s1c1
Sequence:CCGGGAGAAGTCATTGCATTGCTCTCTCGAGAGAGCAATGCAATGACTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004292.1-2378s1c1
Sequence:CCGGCAGTCTGAGACAACTGCTGAACTCGAGTTCAGCAGTTGTCTCAGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004292.2-2378s21c1
Sequence:CCGGCAGTCTGAGACAACTGCTGAACTCGAGTTCAGCAGTTGTCTCAGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004292.1-406s1c2
Sequence:CCGGGCGGAAATCTAACACCCGCCACTCGAGTGGCGGGTGTTAGATTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004292.2-1424s21c1
Sequence:CCGGGAGAAGTCATTGCATTGCTCTCTCGAGAGAGCAATGCAATGACTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004292
RIN1 MISSION shRNA Lentiviral Transduction Particles
Ras and Rab interactor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004292.2-2520s21c1
Sequence:CCGGGAGCCTGCTGAGAAATCCTTTCTCGAGAAAGGATTTCTCAGCAGGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004292.2-406s21c1
Sequence:CCGGGCGGAAATCTAACACCCGCCACTCGAGTGGCGGGTGTTAGATTTCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004292.2-227s21c1
Sequence:CCGGCCACTGTATGACGTGCCCAATCTCGAGATTGGGCACGTCATACAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004292.1-2520s1c1
Sequence:CCGGGAGCCTGCTGAGAAATCCTTTCTCGAGAAAGGATTTCTCAGCAGGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004292.1-227s1c1
Sequence:CCGGCCACTGTATGACGTGCCCAATCTCGAGATTGGGCACGTCATACAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004292.1-1424s1c1
Sequence:CCGGGAGAAGTCATTGCATTGCTCTCTCGAGAGAGCAATGCAATGACTTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004292.1-2378s1c1
Sequence:CCGGCAGTCTGAGACAACTGCTGAACTCGAGTTCAGCAGTTGTCTCAGACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004292.2-2378s21c1
Sequence:CCGGCAGTCTGAGACAACTGCTGAACTCGAGTTCAGCAGTTGTCTCAGACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004292.1-406s1c2
Sequence:CCGGGCGGAAATCTAACACCCGCCACTCGAGTGGCGGGTGTTAGATTTCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004292.2-1424s21c1
Sequence:CCGGGAGAAGTCATTGCATTGCTCTCTCGAGAGAGCAATGCAATGACTTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145495
VALIDATED
RIN1 MISSION shRNA Bacterial Glycerol Stock
Ras and Rab interactor 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145495.2-2582s21c1
Sequence:CCGGCCATAGCCCACAGGGATAAACCTCGAGGTTTATCCCTGTGGGCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145495.2-150s21c1
Sequence:CCGGACTGTATGACACACCTGATACCTCGAGGTATCAGGTGTGTCATACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145495.2-319s21c1
Sequence:CCGGTTCCTGGTGCGGAAATCTAACCTCGAGGTTAGATTTCCGCACCAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145495.2-2012s21c1
Sequence:CCGGTGACCCAACCAGATGCGTTTGCTCGAGCAAACGCATCTGGTTGGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145495.2-2102s21c1
Sequence:CCGGCAACTGGCTACCTCATCTATCCTCGAGGATAGATGAGGTAGCCAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145495.1-1117s1c1
Sequence:CCGGGCAGCCACAATGCTAATGCAACTCGAGTTGCATTAGCATTGTGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145495.1-404s1c1
Sequence:CCGGGCCACTATATCGAAGAGAGTACTCGAGTACTCTCTTCGATATAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145495.1-1681s1c1
Sequence:CCGGCTCCTGTTAGAAGCTGAGTATCTCGAGATACTCAGCTTCTAACAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145495.1-3277s1c1
Sequence:CCGGCCTGAGAAATAATGCACGCTACTCGAGTAGCGTGCATTATTTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145495
VALIDATED
RIN1 MISSION shRNA shRNA Plasmid DNA
Ras and Rab interactor 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145495.2-2582s21c1
Sequence:CCGGCCATAGCCCACAGGGATAAACCTCGAGGTTTATCCCTGTGGGCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145495.2-150s21c1
Sequence:CCGGACTGTATGACACACCTGATACCTCGAGGTATCAGGTGTGTCATACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145495.2-319s21c1
Sequence:CCGGTTCCTGGTGCGGAAATCTAACCTCGAGGTTAGATTTCCGCACCAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145495.2-2012s21c1
Sequence:CCGGTGACCCAACCAGATGCGTTTGCTCGAGCAAACGCATCTGGTTGGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145495.2-2102s21c1
Sequence:CCGGCAACTGGCTACCTCATCTATCCTCGAGGATAGATGAGGTAGCCAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145495.1-1117s1c1
Sequence:CCGGGCAGCCACAATGCTAATGCAACTCGAGTTGCATTAGCATTGTGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145495.1-404s1c1
Sequence:CCGGGCCACTATATCGAAGAGAGTACTCGAGTACTCTCTTCGATATAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145495.1-1681s1c1
Sequence:CCGGCTCCTGTTAGAAGCTGAGTATCTCGAGATACTCAGCTTCTAACAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145495.1-3277s1c1
Sequence:CCGGCCTGAGAAATAATGCACGCTACTCGAGTAGCGTGCATTATTTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145495
VALIDATED
RIN1 MISSION shRNA Lentiviral Transduction Particles
Ras and Rab interactor 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145495.2-2582s21c1
Sequence:CCGGCCATAGCCCACAGGGATAAACCTCGAGGTTTATCCCTGTGGGCTATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145495.2-150s21c1
Sequence:CCGGACTGTATGACACACCTGATACCTCGAGGTATCAGGTGTGTCATACAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145495.2-319s21c1
Sequence:CCGGTTCCTGGTGCGGAAATCTAACCTCGAGGTTAGATTTCCGCACCAGGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145495.2-2012s21c1
Sequence:CCGGTGACCCAACCAGATGCGTTTGCTCGAGCAAACGCATCTGGTTGGGTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145495.2-2102s21c1
Sequence:CCGGCAACTGGCTACCTCATCTATCCTCGAGGATAGATGAGGTAGCCAGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145495.1-1117s1c1
Sequence:CCGGGCAGCCACAATGCTAATGCAACTCGAGTTGCATTAGCATTGTGGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145495.1-404s1c1
Sequence:CCGGGCCACTATATCGAAGAGAGTACTCGAGTACTCTCTTCGATATAGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145495.1-1681s1c1
Sequence:CCGGCTCCTGTTAGAAGCTGAGTATCTCGAGATACTCAGCTTCTAACAGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145495.1-3277s1c1
Sequence:CCGGCCTGAGAAATAATGCACGCTACTCGAGTAGCGTGCATTATTTCTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)