EMAIL THIS PAGE TO A FRIEND

RIN2

Ras and Rab interactor 2

127 Gene Product Result for
Synonyms: MACS RASSF4
UniProtKB ID: Q8WYP3, Q00425, Q5TFT8, Q9BQL3, Q9H071
Gene ID:
Human(54453) Summary: The RAB5 protein is a small GTPase involved in membrane trafficking in the early endocytic pathway. The protein encoded by this gene binds the GTP-bound form of the RAB5 protein preferentially over the GDP-bound form, and functions as a guanine nucleotide exchange factor for RAB5. The encoded protein is found primarily as a tetramer in the cytoplasm and does not bind other members of the RAB family. Mutations in this gene cause macrocephaly alopecia cutis laxa and scoliosis (MACS) syndrome, an elastic tissue disorder, as well as the related connective tissue disorder, RIN2 syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
Mouse(74030) Ras and Rab interactor 2
Rat(311494) Ras and Rab interactor 2
Thale Cress(828626) E3 ubiquitin protein ligase RIN2
chicken(421246) Ras and Rab interactor 2
dog(477139) Ras and Rab interactor 2
domestic cat(101080627) Ras and Rab interactor 2
cow(537459) Ras and Rab interactor 2
sheep(101123061) Ras and Rab interactor 2
domestic guinea pig(100725411) Ras and Rab interactor 2
naked mole-rat(101723666) Ras and Rab interactor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028724 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028724 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028724 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018993 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018993 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018993 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019621 MISSION® esiRNA esiRNA targeting human RIN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018993 Rosetta Predictions human pricing
NM_001107786 Rosetta Predictions rat pricing
NM_028724 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018993 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032679 predicted 2780
2 SASI_Hs01_00032680 predicted 2106
3 SASI_Hs02_00352497 predicted 2166
4 SASI_Hs01_00032681 predicted 2641
5 SASI_Hs01_00032682 predicted 1702
6 SASI_Hs02_00352498 predicted 1592
7 SASI_Hs01_00032683 predicted 2460
8 SASI_Hs01_00032684 predicted 2653
9 SASI_Hs01_00032685 predicted 2398
10 SASI_Hs01_00032687 predicted 564
11 SASI_Hs01_00032686 predicted 2463
12 SASI_Hs01_00032688 predicted 2667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107786 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232255 predicted 2910
2 SASI_Rn02_00232256 predicted 1964
3 SASI_Rn02_00232257 predicted 2893
4 SASI_Rn02_00232258 predicted 1937
5 SASI_Rn02_00232259 predicted 2520
6 SASI_Rn02_00232260 predicted 2823
7 SASI_Rn02_00232261 predicted 942
8 SASI_Rn02_00232262 predicted 2399
9 SASI_Rn02_00232263 predicted 1926
10 SASI_Rn02_00232264 predicted 2781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046687 predicted 2849
2 SASI_Mm01_00046688 predicted 697
3 SASI_Mm01_00046689 predicted 2740
4 SASI_Mm01_00046690 predicted 1881
5 SASI_Mm01_00046692 predicted 2669
6 SASI_Mm01_00046693 predicted 2226
7 SASI_Mm01_00046694 predicted 2378
8 SASI_Mm01_00046695 predicted 383
9 SASI_Mm01_00046696 predicted 1156
10 SASI_Mm02_00334286 predicted 1892
11 SASI_Mm01_00046691 predicted 761
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028724
VALIDATED
RIN2 MISSION shRNA Bacterial Glycerol Stock
Ras and Rab interactor 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028724.2-3851s1c1
Sequence:CCGGGCTGAGAATTAGAAGAGAAATCTCGAGATTTCTCTTCTAATTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028724.2-673s1c1
Sequence:CCGGCCTCTCAAAGAGTTTACTATACTCGAGTATAGTAAACTCTTTGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028724.2-2830s1c1
Sequence:CCGGCCTCAGAAGATCAAGGCTGAACTCGAGTTCAGCCTTGATCTTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028724.2-977s1c1
Sequence:CCGGGCCTTATAAATGGAGTGCATTCTCGAGAATGCACTCCATTTATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028724.2-1839s1c1
Sequence:CCGGCCGGGACAAATGCACCTATTTCTCGAGAAATAGGTGCATTTGTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028724.4-2412s21c1
Sequence:CCGGGCTTGAACTGGACACGGAAATCTCGAGATTTCCGTGTCCAGTTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028724.4-2469s21c1
Sequence:CCGGGCACGGAGAAGGAGGCTATTACTCGAGTAATAGCCTCCTTCTCCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028724.4-748s21c1
Sequence:CCGGGCAGATTTATTCCGGCTTATTCTCGAGAATAAGCCGGAATAAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028724.4-3114s21c1
Sequence:CCGGGGGCATCCTTTAGATACATTGCTCGAGCAATGTATCTAAAGGATGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028724.4-1917s21c1
Sequence:CCGGCCATGTGTCCAGCACCGATATCTCGAGATATCGGTGCTGGACACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028724.4-1940s21c1
Sequence:CCGGTGCAGACCATCCGGCAGTTTACTCGAGTAAACTGCCGGATGGTCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028724
VALIDATED
RIN2 MISSION shRNA shRNA Plasmid DNA
Ras and Rab interactor 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028724.2-3851s1c1
Sequence:CCGGGCTGAGAATTAGAAGAGAAATCTCGAGATTTCTCTTCTAATTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028724.2-673s1c1
Sequence:CCGGCCTCTCAAAGAGTTTACTATACTCGAGTATAGTAAACTCTTTGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028724.2-2830s1c1
Sequence:CCGGCCTCAGAAGATCAAGGCTGAACTCGAGTTCAGCCTTGATCTTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028724.2-977s1c1
Sequence:CCGGGCCTTATAAATGGAGTGCATTCTCGAGAATGCACTCCATTTATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028724.2-1839s1c1
Sequence:CCGGCCGGGACAAATGCACCTATTTCTCGAGAAATAGGTGCATTTGTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028724.4-2412s21c1
Sequence:CCGGGCTTGAACTGGACACGGAAATCTCGAGATTTCCGTGTCCAGTTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028724.4-2469s21c1
Sequence:CCGGGCACGGAGAAGGAGGCTATTACTCGAGTAATAGCCTCCTTCTCCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028724.4-748s21c1
Sequence:CCGGGCAGATTTATTCCGGCTTATTCTCGAGAATAAGCCGGAATAAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028724.4-3114s21c1
Sequence:CCGGGGGCATCCTTTAGATACATTGCTCGAGCAATGTATCTAAAGGATGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028724.4-1917s21c1
Sequence:CCGGCCATGTGTCCAGCACCGATATCTCGAGATATCGGTGCTGGACACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028724.4-1940s21c1
Sequence:CCGGTGCAGACCATCCGGCAGTTTACTCGAGTAAACTGCCGGATGGTCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028724
VALIDATED
RIN2 MISSION shRNA Lentiviral Transduction Particles
Ras and Rab interactor 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028724.2-3851s1c1
Sequence:CCGGGCTGAGAATTAGAAGAGAAATCTCGAGATTTCTCTTCTAATTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028724.2-673s1c1
Sequence:CCGGCCTCTCAAAGAGTTTACTATACTCGAGTATAGTAAACTCTTTGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028724.2-2830s1c1
Sequence:CCGGCCTCAGAAGATCAAGGCTGAACTCGAGTTCAGCCTTGATCTTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028724.2-977s1c1
Sequence:CCGGGCCTTATAAATGGAGTGCATTCTCGAGAATGCACTCCATTTATAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028724.2-1839s1c1
Sequence:CCGGCCGGGACAAATGCACCTATTTCTCGAGAAATAGGTGCATTTGTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028724.4-2412s21c1
Sequence:CCGGGCTTGAACTGGACACGGAAATCTCGAGATTTCCGTGTCCAGTTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028724.4-2469s21c1
Sequence:CCGGGCACGGAGAAGGAGGCTATTACTCGAGTAATAGCCTCCTTCTCCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028724.4-748s21c1
Sequence:CCGGGCAGATTTATTCCGGCTTATTCTCGAGAATAAGCCGGAATAAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028724.4-3114s21c1
Sequence:CCGGGGGCATCCTTTAGATACATTGCTCGAGCAATGTATCTAAAGGATGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028724.4-1917s21c1
Sequence:CCGGCCATGTGTCCAGCACCGATATCTCGAGATATCGGTGCTGGACACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028724.4-1940s21c1
Sequence:CCGGTGCAGACCATCCGGCAGTTTACTCGAGTAAACTGCCGGATGGTCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018993
VALIDATED
RIN2 MISSION shRNA Bacterial Glycerol Stock
Ras and Rab interactor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018993.2-2659s1c1
Sequence:CCGGCGCATCAAGAACGATCCTTATCTCGAGATAAGGATCGTTCTTGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018993.2-569s1c1
Sequence:CCGGGCAGGGATGTTCTACCATTTACTCGAGTAAATGGTAGAACATCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018993.2-393s1c1
Sequence:CCGGCCTGGTTCATAAATCTACCAACTCGAGTTGGTAGATTTATGAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018993.2-2659s21c1
Sequence:CCGGCGCATCAAGAACGATCCTTATCTCGAGATAAGGATCGTTCTTGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018993.2-569s21c1
Sequence:CCGGGCAGGGATGTTCTACCATTTACTCGAGTAAATGGTAGAACATCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018993.2-2863s21c1
Sequence:CCGGACTCGGCCAAGGGCAACTTTACTCGAGTAAAGTTGCCCTTGGCCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018993.2-519s21c1
Sequence:CCGGAGGAATCAGTTTCGCAGATTTCTCGAGAAATCTGCGAAACTGATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018993.2-647s21c1
Sequence:CCGGTGGCCCAGATGGGACTAAATTCTCGAGAATTTAGTCCCATCTGGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018993
VALIDATED
RIN2 MISSION shRNA shRNA Plasmid DNA
Ras and Rab interactor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018993.2-2659s1c1
Sequence:CCGGCGCATCAAGAACGATCCTTATCTCGAGATAAGGATCGTTCTTGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018993.2-569s1c1
Sequence:CCGGGCAGGGATGTTCTACCATTTACTCGAGTAAATGGTAGAACATCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018993.2-393s1c1
Sequence:CCGGCCTGGTTCATAAATCTACCAACTCGAGTTGGTAGATTTATGAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018993.2-2659s21c1
Sequence:CCGGCGCATCAAGAACGATCCTTATCTCGAGATAAGGATCGTTCTTGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018993.2-569s21c1
Sequence:CCGGGCAGGGATGTTCTACCATTTACTCGAGTAAATGGTAGAACATCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018993.2-2863s21c1
Sequence:CCGGACTCGGCCAAGGGCAACTTTACTCGAGTAAAGTTGCCCTTGGCCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018993.2-519s21c1
Sequence:CCGGAGGAATCAGTTTCGCAGATTTCTCGAGAAATCTGCGAAACTGATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018993.2-647s21c1
Sequence:CCGGTGGCCCAGATGGGACTAAATTCTCGAGAATTTAGTCCCATCTGGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018993
VALIDATED
RIN2 MISSION shRNA Lentiviral Transduction Particles
Ras and Rab interactor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018993.2-2659s1c1
Sequence:CCGGCGCATCAAGAACGATCCTTATCTCGAGATAAGGATCGTTCTTGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018993.2-569s1c1
Sequence:CCGGGCAGGGATGTTCTACCATTTACTCGAGTAAATGGTAGAACATCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018993.2-393s1c1
Sequence:CCGGCCTGGTTCATAAATCTACCAACTCGAGTTGGTAGATTTATGAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018993.2-2659s21c1
Sequence:CCGGCGCATCAAGAACGATCCTTATCTCGAGATAAGGATCGTTCTTGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018993.2-569s21c1
Sequence:CCGGGCAGGGATGTTCTACCATTTACTCGAGTAAATGGTAGAACATCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018993.2-2863s21c1
Sequence:CCGGACTCGGCCAAGGGCAACTTTACTCGAGTAAAGTTGCCCTTGGCCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018993.2-519s21c1
Sequence:CCGGAGGAATCAGTTTCGCAGATTTCTCGAGAAATCTGCGAAACTGATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018993.2-647s21c1
Sequence:CCGGTGGCCCAGATGGGACTAAATTCTCGAGAATTTAGTCCCATCTGGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)