EMAIL THIS PAGE TO A FRIEND

RINL

Ras and Rab interactor-like

47 Gene Product Result for
UniProtKB ID: Q6ZS11, B4DPG5
Gene ID:
Mouse(320435) Ras and Rab interactor-like
Rat(292760) Ras and Rab interactor-like
domestic cat(101093480) Ras and Rab interactor-like
dog(484520) Ras and Rab interactor-like
naked mole-rat(101714792) Ras and Rab interactor-like
domestic guinea pig(100729799) Ras and Rab interactor-like
cow(504464) Ras and Rab interactor-like
sheep(101113356) Ras and Rab interactor-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177158 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177158 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177158 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198445 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198445 Rosetta Predictions human pricing
NM_001106241 Rosetta Predictions rat pricing
NM_177158 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371954 predicted 467
2 SASI_Hs01_00170384 predicted 1468
3 SASI_Hs01_00170385 predicted 1457
4 SASI_Hs01_00170386 predicted 1460
5 SASI_Hs01_00170387 predicted 402
6 SASI_Hs01_00170388 predicted 1456
7 SASI_Hs01_00170389 predicted 1459
8 SASI_Hs01_00170390 predicted 1451
9 SASI_Hs01_00170391 predicted 1484
10 SASI_Hs01_00170392 predicted 468
11 SASI_Hs01_00170383 predicted 1525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217028 predicted 389
2 SASI_Rn02_00217029 predicted 1023
3 SASI_Rn02_00217030 predicted 552
4 SASI_Rn02_00217031 predicted 985
5 SASI_Rn02_00217032 predicted 378
6 SASI_Rn02_00217033 predicted 973
7 SASI_Rn02_00217034 predicted 1008
8 SASI_Rn02_00217035 predicted 1015
9 SASI_Rn02_00217036 predicted 894
10 SASI_Rn02_00217037 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177158 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150334 predicted 334
2 SASI_Mm01_00150335 predicted 1454
3 SASI_Mm01_00150336 predicted 330
4 SASI_Mm01_00150337 predicted 957
5 SASI_Mm02_00347154 predicted 812
6 SASI_Mm01_00150338 predicted 950
7 SASI_Mm01_00150339 predicted 1896
8 SASI_Mm01_00150341 predicted 1971
9 SASI_Mm01_00150342 predicted 707
10 SASI_Mm01_00150343 predicted 948
11 SASI_Mm01_00150340 predicted 233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177158
RINL MISSION shRNA Bacterial Glycerol Stock
Ras and Rab interactor-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177158.2-950s1c1
Sequence:CCGGGCCTCATCTCAGATTCTGGAACTCGAGTTCCAGAATCTGAGATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177158.2-1458s1c1
Sequence:CCGGGCTGATCTGGAGTCCACATATCTCGAGATATGTGGACTCCAGATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177158.2-223s1c1
Sequence:CCGGCCCGAGCTGGATGCTCAGTATCTCGAGATACTGAGCATCCAGCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177158.2-2528s1c1
Sequence:CCGGGCCATCATTGAAGATGATAAACTCGAGTTTATCATCTTCAATGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177158.2-499s1c1
Sequence:CCGGGCTGGAGATAATCACTCAGATCTCGAGATCTGAGTGATTATCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177158
RINL MISSION shRNA shRNA Plasmid DNA
Ras and Rab interactor-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177158.2-950s1c1
Sequence:CCGGGCCTCATCTCAGATTCTGGAACTCGAGTTCCAGAATCTGAGATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177158.2-1458s1c1
Sequence:CCGGGCTGATCTGGAGTCCACATATCTCGAGATATGTGGACTCCAGATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177158.2-223s1c1
Sequence:CCGGCCCGAGCTGGATGCTCAGTATCTCGAGATACTGAGCATCCAGCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177158.2-2528s1c1
Sequence:CCGGGCCATCATTGAAGATGATAAACTCGAGTTTATCATCTTCAATGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177158.2-499s1c1
Sequence:CCGGGCTGGAGATAATCACTCAGATCTCGAGATCTGAGTGATTATCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177158
RINL MISSION shRNA Lentiviral Transduction Particles
Ras and Rab interactor-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177158.2-950s1c1
Sequence:CCGGGCCTCATCTCAGATTCTGGAACTCGAGTTCCAGAATCTGAGATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177158.2-1458s1c1
Sequence:CCGGGCTGATCTGGAGTCCACATATCTCGAGATATGTGGACTCCAGATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177158.2-223s1c1
Sequence:CCGGCCCGAGCTGGATGCTCAGTATCTCGAGATACTGAGCATCCAGCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177158.2-2528s1c1
Sequence:CCGGGCCATCATTGAAGATGATAAACTCGAGTTTATCATCTTCAATGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177158.2-499s1c1
Sequence:CCGGGCTGGAGATAATCACTCAGATCTCGAGATCTGAGTGATTATCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198445
RINL MISSION shRNA Bacterial Glycerol Stock
Ras and Rab interactor-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164177    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198445.1-2088s1c1
Sequence:CCGGCAGCCTGACAAACATGGAGAACTCGAGTTCTCCATGTTTGTCAGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198445.1-544s1c1
Sequence:CCGGGCTTTCCATTGTGAACCAGCTCTCGAGAGCTGGTTCACAATGGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159236    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198445.1-1911s1c1
Sequence:CCGGCAAAGAATGTATCACATGCTACTCGAGTAGCATGTGATACATTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198445.1-1471s1c1
Sequence:CCGGCGTAGAGTTTCTTATGGAGCTCTCGAGAGCTCCATAAGAAACTCTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198445.1-538s1c1
Sequence:CCGGGAAGGTGCTTTCCATTGTGAACTCGAGTTCACAATGGAAAGCACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160338    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198445.1-1923s1c1
Sequence:CCGGCACATGCTAACAAACCATATACTCGAGTATATGGTTTGTTAGCATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198445.1-1465s1c1
Sequence:CCGGGCTGGACGTAGAGTTTCTTATCTCGAGATAAGAAACTCTACGTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198445.1-1340s1c1
Sequence:CCGGGAGGTGTGCAGAGATGTCTATCTCGAGATAGACATCTCTGCACACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198445.1-758s1c1
Sequence:CCGGGACCTTGAAGGAAAGGAGGAACTCGAGTTCCTCCTTTCCTTCAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198445
RINL MISSION shRNA shRNA Plasmid DNA
Ras and Rab interactor-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164177    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198445.1-2088s1c1
Sequence:CCGGCAGCCTGACAAACATGGAGAACTCGAGTTCTCCATGTTTGTCAGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198445.1-544s1c1
Sequence:CCGGGCTTTCCATTGTGAACCAGCTCTCGAGAGCTGGTTCACAATGGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159236    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198445.1-1911s1c1
Sequence:CCGGCAAAGAATGTATCACATGCTACTCGAGTAGCATGTGATACATTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198445.1-1471s1c1
Sequence:CCGGCGTAGAGTTTCTTATGGAGCTCTCGAGAGCTCCATAAGAAACTCTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198445.1-538s1c1
Sequence:CCGGGAAGGTGCTTTCCATTGTGAACTCGAGTTCACAATGGAAAGCACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160338    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198445.1-1923s1c1
Sequence:CCGGCACATGCTAACAAACCATATACTCGAGTATATGGTTTGTTAGCATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198445.1-1465s1c1
Sequence:CCGGGCTGGACGTAGAGTTTCTTATCTCGAGATAAGAAACTCTACGTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198445.1-1340s1c1
Sequence:CCGGGAGGTGTGCAGAGATGTCTATCTCGAGATAGACATCTCTGCACACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198445.1-758s1c1
Sequence:CCGGGACCTTGAAGGAAAGGAGGAACTCGAGTTCCTCCTTTCCTTCAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198445
RINL MISSION shRNA Lentiviral Transduction Particles
Ras and Rab interactor-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164177    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198445.1-2088s1c1
Sequence:CCGGCAGCCTGACAAACATGGAGAACTCGAGTTCTCCATGTTTGTCAGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198445.1-544s1c1
Sequence:CCGGGCTTTCCATTGTGAACCAGCTCTCGAGAGCTGGTTCACAATGGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159236    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198445.1-1911s1c1
Sequence:CCGGCAAAGAATGTATCACATGCTACTCGAGTAGCATGTGATACATTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198445.1-1471s1c1
Sequence:CCGGCGTAGAGTTTCTTATGGAGCTCTCGAGAGCTCCATAAGAAACTCTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198445.1-538s1c1
Sequence:CCGGGAAGGTGCTTTCCATTGTGAACTCGAGTTCACAATGGAAAGCACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160338    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198445.1-1923s1c1
Sequence:CCGGCACATGCTAACAAACCATATACTCGAGTATATGGTTTGTTAGCATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198445.1-1465s1c1
Sequence:CCGGGCTGGACGTAGAGTTTCTTATCTCGAGATAAGAAACTCTACGTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198445.1-1340s1c1
Sequence:CCGGGAGGTGTGCAGAGATGTCTATCTCGAGATAGACATCTCTGCACACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198445.1-758s1c1
Sequence:CCGGGACCTTGAAGGAAAGGAGGAACTCGAGTTCCTCCTTTCCTTCAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)