EMAIL THIS PAGE TO A FRIEND

RIOK1

RIO kinase 1

84 Gene Product Result for
Synonyms: AD034 RRP10 bA288G3.1
UniProtKB ID: Q9BRS2, B2RB28, Q8NDC8, Q96NV9
Gene ID:
Human(83732) Summary: This gene includes two alternatively spliced transcript variants, which encode different isoforms. The function of this gene has not been determined. [provided by RefSeq, Jul 2008]
Mouse(71340) RIO kinase 1 (yeast)
Rat(291061) RIO kinase 1
Zebrafish(406268) RIO kinase 1 (yeast)
dog(478713) RIO kinase 1 (yeast)
Horse(100050980) RIO kinase 1 (yeast)
chicken(420870) RIO kinase 1 (yeast)
Domestic Rabbit(100354362) RIO kinase 1 (yeast)
cow(516289) RIO kinase 1
sheep(101107559) RIO kinase 1 (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024242 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024242 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024242 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031480 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031480 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031480 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031480 Rosetta Predictions human pricing
NM_153005 Rosetta Predictions human pricing
XM_001063945 Rosetta Predictions rat pricing
XM_214454 Rosetta Predictions rat pricing
NM_024242 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120827 predicted 1346
2 SASI_Hs01_00120828 predicted 1109
3 SASI_Hs01_00120829 predicted 1361
4 SASI_Hs01_00120831 predicted 1495
5 SASI_Hs02_00358913 predicted 1440
6 SASI_Hs01_00120832 predicted 1286
7 SASI_Hs01_00120833 predicted 1124
8 SASI_Hs01_00120834 predicted 1150
9 SASI_Hs02_00358914 predicted 1404
10 SASI_Hs02_00358915 predicted 1334
11 SASI_Hs01_00120826 predicted 1536
12 SASI_Hs01_00120830 predicted 1080
13 SASI_Hs01_00120835 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195304 predicted 663
2 SASI_Hs01_00195305 predicted 417
3 SASI_Hs01_00195306 predicted 669
4 SASI_Hs01_00195308 predicted 804
5 SASI_Hs02_00366965 predicted 748
6 SASI_Hs01_00195309 predicted 593
7 SASI_Hs01_00195310 predicted 428
8 SASI_Hs01_00195311 predicted 455
9 SASI_Hs02_00366966 predicted 711
10 SASI_Hs02_00366967 predicted 645
11 SASI_Hs01_00195303 predicted 848
12 SASI_Hs01_00195307 predicted 391
13 SASI_Hs01_00195312 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063945 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308819 predicted 1499
2 SASI_Rn02_00308820 predicted 994
3 SASI_Rn02_00308821 predicted 1499
4 SASI_Rn02_00308822 predicted 710
5 SASI_Rn02_00308823 predicted 433
6 SASI_Rn02_00308824 predicted 984
7 SASI_Rn02_00308825 predicted 596
8 SASI_Rn02_00308826 predicted 1109
9 SASI_Rn02_00308827 predicted 1463
10 SASI_Rn02_00308828 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214454 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375305 predicted 354
2 SASI_Rn02_00375306 predicted 658
3 SASI_Rn02_00375307 predicted 708
4 SASI_Rn02_00375308 predicted 436
5 SASI_Rn02_00375309 predicted 599
6 SASI_Rn02_00375310 predicted 423
7 SASI_Rn02_00375311 predicted 595
8 SASI_Rn02_00375312 predicted 454
9 SASI_Rn02_00375313 predicted 462
10 SASI_Rn02_00375314 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178475 predicted 1097
2 SASI_Mm01_00178476 predicted 1212
3 SASI_Mm01_00178477 predicted 941
4 SASI_Mm01_00178478 predicted 1460
5 SASI_Mm02_00327620 predicted 445
6 SASI_Mm01_00178479 predicted 1241
7 SASI_Mm01_00178480 predicted 1493
8 SASI_Mm01_00178481 predicted 952
9 SASI_Mm01_00178482 predicted 452
10 SASI_Mm01_00178483 predicted 973
11 SASI_Mm01_00178484 predicted 739
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024242
RIOK1 MISSION shRNA Bacterial Glycerol Stock
RIO kinase 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024242.2-545s21c1
Sequence:CCGGTACTGATTCTGTGACAAATAACTCGAGTTATTTGTCACAGAATCAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024242.2-2025s21c1
Sequence:CCGGACGGACTTATTAAGGTATTATCTCGAGATAATACCTTAATAAGTCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024242.2-809s21c1
Sequence:CCGGGATGTTCAAAGATCGTGATAACTCGAGTTATCACGATCTTTGAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024242.2-2142s21c1
Sequence:CCGGCGGACGAACTTGGGAACATTTCTCGAGAAATGTTCCCAAGTTCGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024242.2-1456s1c1
Sequence:CCGGCCAGAACCTTAAACGAAGTAACTCGAGTTACTTCGTTTAAGGTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024242.2-425s1c1
Sequence:CCGGCGGCAGTAACTATCAGGCAAACTCGAGTTTGCCTGATAGTTACTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024242.2-1615s1c1
Sequence:CCGGCGCTCCTAGAAAGTGAAGTTACTCGAGTAACTTCACTTTCTAGGAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024242.2-446s1c1
Sequence:CCGGCCGACAGACTTCTAACTACAACTCGAGTTGTAGTTAGAAGTCTGTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024242.2-594s1c1
Sequence:CCGGGCAGAATCGTATCGAATTAAACTCGAGTTTAATTCGATACGATTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024242.2-1434s21c1
Sequence:CCGGGTGTTCAAACAAGCATATATTCTCGAGAATATATGCTTGTTTGAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024242.2-1497s21c1
Sequence:CCGGGACATCATGATGAGGTTAAAGCTCGAGCTTTAACCTCATCATGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024242
RIOK1 MISSION shRNA shRNA Plasmid DNA
RIO kinase 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024242.2-545s21c1
Sequence:CCGGTACTGATTCTGTGACAAATAACTCGAGTTATTTGTCACAGAATCAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024242.2-2025s21c1
Sequence:CCGGACGGACTTATTAAGGTATTATCTCGAGATAATACCTTAATAAGTCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024242.2-809s21c1
Sequence:CCGGGATGTTCAAAGATCGTGATAACTCGAGTTATCACGATCTTTGAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024242.2-2142s21c1
Sequence:CCGGCGGACGAACTTGGGAACATTTCTCGAGAAATGTTCCCAAGTTCGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024242.2-1456s1c1
Sequence:CCGGCCAGAACCTTAAACGAAGTAACTCGAGTTACTTCGTTTAAGGTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024242.2-425s1c1
Sequence:CCGGCGGCAGTAACTATCAGGCAAACTCGAGTTTGCCTGATAGTTACTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024242.2-1615s1c1
Sequence:CCGGCGCTCCTAGAAAGTGAAGTTACTCGAGTAACTTCACTTTCTAGGAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024242.2-446s1c1
Sequence:CCGGCCGACAGACTTCTAACTACAACTCGAGTTGTAGTTAGAAGTCTGTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024242.2-594s1c1
Sequence:CCGGGCAGAATCGTATCGAATTAAACTCGAGTTTAATTCGATACGATTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024242.2-1434s21c1
Sequence:CCGGGTGTTCAAACAAGCATATATTCTCGAGAATATATGCTTGTTTGAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024242.2-1497s21c1
Sequence:CCGGGACATCATGATGAGGTTAAAGCTCGAGCTTTAACCTCATCATGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024242
RIOK1 MISSION shRNA Lentiviral Transduction Particles
RIO kinase 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024242.2-545s21c1
Sequence:CCGGTACTGATTCTGTGACAAATAACTCGAGTTATTTGTCACAGAATCAGTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000416943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024242.2-2025s21c1
Sequence:CCGGACGGACTTATTAAGGTATTATCTCGAGATAATACCTTAATAAGTCCGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000418485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024242.2-809s21c1
Sequence:CCGGGATGTTCAAAGATCGTGATAACTCGAGTTATCACGATCTTTGAACATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000427874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024242.2-2142s21c1
Sequence:CCGGCGGACGAACTTGGGAACATTTCTCGAGAAATGTTCCCAAGTTCGTCCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000023866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024242.2-1456s1c1
Sequence:CCGGCCAGAACCTTAAACGAAGTAACTCGAGTTACTTCGTTTAAGGTTCTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000023864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024242.2-425s1c1
Sequence:CCGGCGGCAGTAACTATCAGGCAAACTCGAGTTTGCCTGATAGTTACTGCCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000023865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024242.2-1615s1c1
Sequence:CCGGCGCTCCTAGAAAGTGAAGTTACTCGAGTAACTTCACTTTCTAGGAGCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000023867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024242.2-446s1c1
Sequence:CCGGCCGACAGACTTCTAACTACAACTCGAGTTGTAGTTAGAAGTCTGTCGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000023868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024242.2-594s1c1
Sequence:CCGGGCAGAATCGTATCGAATTAAACTCGAGTTTAATTCGATACGATTCTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000425168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024242.2-1434s21c1
Sequence:CCGGGTGTTCAAACAAGCATATATTCTCGAGAATATATGCTTGTTTGAACACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000416051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024242.2-1497s21c1
Sequence:CCGGGACATCATGATGAGGTTAAAGCTCGAGCTTTAACCTCATCATGATGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031480
VALIDATED
RIOK1 MISSION shRNA Bacterial Glycerol Stock
RIO kinase 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_031480.2-1000s1c1
Sequence:CCGGGTCATGAGTTTCATCGGTAAACTCGAGTTTACCGATGAAACTCATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031480.2-1495s1c1
Sequence:CCGGGAGAGGGATATGGACATAATTCTCGAGAATTATGTCCATATCCCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031480.2-2309s1c1
Sequence:CCGGGCCATGTTTATATAAAGGGAACTCGAGTTCCCTTTATATAAACATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_031480.2-254s1c1
Sequence:CCGGGAGACTTGAAGACAGTCAAAGCTCGAGCTTTGACTGTCTTCAAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031480.2-1452s1c1
Sequence:CCGGGCGAGCATATATTCCTAGAACCTCGAGGTTCTAGGAATATATGCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031480.2-551s21c1
Sequence:CCGGATGTTACTGATTCCGTCATAACTCGAGTTATGACGGAATCAGTAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031480.2-1572s21c1
Sequence:CCGGCCAGACTGTTACAGGATTGAACTCGAGTTCAATCCTGTAACAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031480.2-412s21c1
Sequence:CCGGGCCAAGGGTTATGTCTGGAATCTCGAGATTCCAGACATAACCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_031480.2-604s1c1
Sequence:CCGGGCAGATATGTATCGCATCAAACTCGAGTTTGATGCGATACATATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_031480.2-1572s1c1
Sequence:CCGGCCAGACTGTTACAGGATTGAACTCGAGTTCAATCCTGTAACAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031480.2-304s1c1
Sequence:CCGGCAAGACAATGTGAATGAGAATCTCGAGATTCTCATTCACATTGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031480.2-412s1c1
Sequence:CCGGGCCAAGGGTTATGTCTGGAATCTCGAGATTCCAGACATAACCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_031480.2-604s21c1
Sequence:CCGGGCAGATATGTATCGCATCAAACTCGAGTTTGATGCGATACATATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_031480.2-1997s21c1
Sequence:CCGGTCTGTGAAGACGGATTCAAATCTCGAGATTTGAATCCGTCTTCACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031480
VALIDATED
RIOK1 MISSION shRNA shRNA Plasmid DNA
RIO kinase 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_031480.2-1000s1c1
Sequence:CCGGGTCATGAGTTTCATCGGTAAACTCGAGTTTACCGATGAAACTCATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031480.2-1495s1c1
Sequence:CCGGGAGAGGGATATGGACATAATTCTCGAGAATTATGTCCATATCCCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031480.2-2309s1c1
Sequence:CCGGGCCATGTTTATATAAAGGGAACTCGAGTTCCCTTTATATAAACATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_031480.2-254s1c1
Sequence:CCGGGAGACTTGAAGACAGTCAAAGCTCGAGCTTTGACTGTCTTCAAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031480.2-1452s1c1
Sequence:CCGGGCGAGCATATATTCCTAGAACCTCGAGGTTCTAGGAATATATGCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031480.2-551s21c1
Sequence:CCGGATGTTACTGATTCCGTCATAACTCGAGTTATGACGGAATCAGTAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031480.2-1572s21c1
Sequence:CCGGCCAGACTGTTACAGGATTGAACTCGAGTTCAATCCTGTAACAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031480.2-412s21c1
Sequence:CCGGGCCAAGGGTTATGTCTGGAATCTCGAGATTCCAGACATAACCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_031480.2-604s1c1
Sequence:CCGGGCAGATATGTATCGCATCAAACTCGAGTTTGATGCGATACATATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_031480.2-1572s1c1
Sequence:CCGGCCAGACTGTTACAGGATTGAACTCGAGTTCAATCCTGTAACAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031480.2-304s1c1
Sequence:CCGGCAAGACAATGTGAATGAGAATCTCGAGATTCTCATTCACATTGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031480.2-412s1c1
Sequence:CCGGGCCAAGGGTTATGTCTGGAATCTCGAGATTCCAGACATAACCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_031480.2-604s21c1
Sequence:CCGGGCAGATATGTATCGCATCAAACTCGAGTTTGATGCGATACATATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_031480.2-1997s21c1
Sequence:CCGGTCTGTGAAGACGGATTCAAATCTCGAGATTTGAATCCGTCTTCACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031480
VALIDATED
RIOK1 MISSION shRNA Lentiviral Transduction Particles
RIO kinase 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_031480.2-1000s1c1
Sequence:CCGGGTCATGAGTTTCATCGGTAAACTCGAGTTTACCGATGAAACTCATGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000196553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031480.2-1495s1c1
Sequence:CCGGGAGAGGGATATGGACATAATTCTCGAGAATTATGTCCATATCCCTCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000196740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031480.2-2309s1c1
Sequence:CCGGGCCATGTTTATATAAAGGGAACTCGAGTTCCCTTTATATAAACATGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000196981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_031480.2-254s1c1
Sequence:CCGGGAGACTTGAAGACAGTCAAAGCTCGAGCTTTGACTGTCTTCAAGTCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000197073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031480.2-1452s1c1
Sequence:CCGGGCGAGCATATATTCCTAGAACCTCGAGGTTCTAGGAATATATGCTCGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031480.2-551s21c1
Sequence:CCGGATGTTACTGATTCCGTCATAACTCGAGTTATGACGGAATCAGTAACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000298707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031480.2-1572s21c1
Sequence:CCGGCCAGACTGTTACAGGATTGAACTCGAGTTCAATCCTGTAACAGTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000298759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031480.2-412s21c1
Sequence:CCGGGCCAAGGGTTATGTCTGGAATCTCGAGATTCCAGACATAACCCTTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000037399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_031480.2-604s1c1
Sequence:CCGGGCAGATATGTATCGCATCAAACTCGAGTTTGATGCGATACATATCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000037400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_031480.2-1572s1c1
Sequence:CCGGCCAGACTGTTACAGGATTGAACTCGAGTTCAATCCTGTAACAGTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000037403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031480.2-304s1c1
Sequence:CCGGCAAGACAATGTGAATGAGAATCTCGAGATTCTCATTCACATTGTCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000037401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031480.2-412s1c1
Sequence:CCGGGCCAAGGGTTATGTCTGGAATCTCGAGATTCCAGACATAACCCTTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000298706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_031480.2-604s21c1
Sequence:CCGGGCAGATATGTATCGCATCAAACTCGAGTTTGATGCGATACATATCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_031480.2-1997s21c1
Sequence:CCGGTCTGTGAAGACGGATTCAAATCTCGAGATTTGAATCCGTCTTCACAGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???