EMAIL THIS PAGE TO A FRIEND

RIPK2

receptor-interacting serine-threonine kinase 2

98 Gene Product Result for
Synonyms: CARD3 CARDIAK CCK GIG30 RICK RIP2
UniProtKB ID: O43353, Q6UWF0
Gene ID:
Human(8767) Summary: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli. [provided by RefSeq, Jul 2008]
Mouse(192656) receptor (TNFRSF)-interacting serine-threonine kinase 2
Rat(362491) receptor-interacting serine-threonine kinase 2
Zebrafish(373874) receptor-interacting serine-threonine kinase 2
Horse(100051086) receptor-interacting serine-threonine kinase 2
domestic cat(101086783) receptor-interacting serine-threonine kinase 2
chicken(420215) receptor-interacting serine-threonine kinase 2
dog(477936) receptor-interacting serine-threonine kinase 2
Domestic Rabbit(100351901) receptor-interacting serine-threonine kinase 2
naked mole-rat(101709696) receptor-interacting serine-threonine kinase 2
domestic guinea pig(100716133) receptor-interacting serine-threonine kinase 2
cow(534407) receptor-interacting serine-threonine kinase 2
sheep(101115883) receptor-interacting serine-threonine kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504642 Anti-phospho-RIPK2 (pSer176) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
ABC332 Anti-RICK Antibody Anti-RICK Antibody is a highly specific rabbit polyclonal antibody, that targets RICK & has been tested in western blotting & ICC. human
immunocytochemistry, western blot pricing
SAB3500426 Anti-RICK antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
R9650 Anti-RICK, C-Terminal antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
R5400 Anti-RICK, N-Terminal antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
R7530 Anti-RIPK2 (466-480) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
R7655 Anti-RIPK2 (507-520) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1412099 ANTI-RIPK2 antibody produced in mouse clone 7F5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1412210 ANTI-RIPK2 antibody produced in mouse clone 3D9, purified immunoglobulin, buffered aqueous solution human,
ELISA, immunohistochemistry, western blot pricing
HPA015273 Anti-RIPK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
HPA016499 Anti-RIPK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503468 Anti-RIPK2 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing
MABC662 Anti-RIPK2 Antibody, clone 1H10.1 Anti-RIPK2 Antibody, clone 1H10.1 is an antibody against RIPK2 for use in Western Blotting and Immunohistochemistry. human
immunohistochemistry, western blot pricing
WH0008767M1 Monoclonal Anti-RIPK2 antibody produced in mouse clone 2C7, purified immunoglobulin, buffered aqueous solution rat, mouse, human
ELISA, western blot pricing
SAB1404621 Monoclonal Anti-RIPK2, (C-terminal) antibody produced in mouse clone 6F7, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
14-612-M RIPK2 Protein, active, 10 µg Active, human RIPK2, amino acids 1-299, for use in Kinase Assays. activity assay pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003821 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003821 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003821 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138952 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138952 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138952 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003821 siRNAs that have been validated in the lab human pricing
XM_001056736 Rosetta Predictions rat pricing
XM_342810 Rosetta Predictions rat pricing
NM_138952 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003821 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199696 validated 928
1 SASI_Hs01_00199694 validated 1342
2 SASI_Hs01_00199695 predicted 1138
3 SASI_Hs01_00199698 predicted 1003
4 SASI_Hs02_00336368 predicted 618
5 SASI_Hs01_00199699 predicted 1095
6 SASI_Hs01_00199700 predicted 683
7 SASI_Hs01_00199701 predicted 1019
8 SASI_Hs02_00336369 predicted 608
9 SASI_Hs01_00199702 predicted 1671
10 SASI_Hs01_00199697 predicted 1263
11 SASI_Hs01_00199703 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056736 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284235 predicted 356
2 SASI_Rn02_00284236 predicted 960
3 SASI_Rn02_00284237 predicted 922
4 SASI_Rn02_00284238 predicted 1464
5 SASI_Rn02_00284239 predicted 372
6 SASI_Rn02_00284240 predicted 317
7 SASI_Rn02_00284241 predicted 637
8 SASI_Rn02_00284242 predicted 1082
9 SASI_Rn02_00284243 predicted 562
10 SASI_Rn02_00284244 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342810 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394831 predicted 943
2 SASI_Rn02_00394832 predicted 906
3 SASI_Rn02_00394833 predicted 1444
4 SASI_Rn02_00394834 predicted 1296
5 SASI_Rn02_00394835 predicted 1068
6 SASI_Rn02_00394836 predicted 902
7 SASI_Rn02_00394837 predicted 761
8 SASI_Rn02_00394838 predicted 1133
9 SASI_Rn02_00394839 predicted 1075
10 SASI_Rn02_00394840 predicted 1619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138952 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188069 predicted 745
2 SASI_Mm01_00188070 predicted 979
3 SASI_Mm01_00188071 predicted 285
4 SASI_Mm01_00188072 predicted 1390
5 SASI_Mm01_00188073 predicted 476
6 SASI_Mm01_00188074 predicted 857
7 SASI_Mm02_00339843 predicted 229
8 SASI_Mm01_00188075 predicted 545
9 SASI_Mm01_00188076 predicted 1354
10 SASI_Mm01_00188077 predicted 535
11 SASI_Mm01_00188078 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003821
VALIDATED
RIPK2 MISSION shRNA Bacterial Glycerol Stock
receptor-interacting serine-threonine kinase 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003821.5-2272s21c1
Sequence:GTACCGGACTTGTCTAAGATGCAATTTGCTCGAGCAAATTGCATCTTAGACAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003821.5-2364s21c1
Sequence:CCGGTTGCCCTACAAAGGGTTATTACTCGAGTAATAACCCTTTGTAGGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003821.5-604s21c1
Sequence:GTACCGGACATGCCAAATGGATCATTAACTCGAGTTAATGATCCATTTGGCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003821.5-2017s1c1
Sequence:CCGGCCGTGAGTATTAAAGCTTTATCTCGAGATAAAGCTTTAATACTCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003821.5-1010s21c1
Sequence:GTACCGGCACCAATCCTTTGCAGATAATCTCGAGATTATCTGCAAAGGATTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003821.5-1047s21c1
Sequence:GTACCGGGGACATCGACCTGTTATTAATCTCGAGATTAATAACAGGTCGATGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003821.5-931s21c1
Sequence:CCGGCCAGTATCAAGCACGATATATCTCGAGATATATCGTGCTTGATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003821.5-1864s21c1
Sequence:GTACCGGTTCAGCCTTACCCGGAAATACCTCGAGGTATTTCCGGGTAAGGCTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003821.5-841s21c1
Sequence:GTACCGGCACAGTCACGAAGTAGCAAATCTCGAGATTTGCTACTTCGTGACTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003821.4-2291s1c1
Sequence:CCGGCCAGGCTTAATTGCCCTACAACTCGAGTTGTAGGGCAATTAAGCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003821.5-2269s1c1
Sequence:CCGGGTTACTTGTCTAAGATGCAATCTCGAGATTGCATCTTAGACAAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003821.4-867s1c1
Sequence:CCGGGCCAGTATCAAGCACGATATACTCGAGTATATCGTGCTTGATACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003821.4-656s1c1
Sequence:CCGGGCACAATATGACTCCTCCTTTCTCGAGAAAGGAGGAGTCATATTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003821.4-1438s1c1
Sequence:CCGGGCACCATTTCTGGATCTCAAACTCGAGTTTGAGATCCAGAAATGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003821.4-1164s1c1
Sequence:CCGGGCTGTTATTCAGCTAAAGAAACTCGAGTTTCTTTAGCTGAATAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003821
VALIDATED
RIPK2 MISSION shRNA shRNA Plasmid DNA
receptor-interacting serine-threonine kinase 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003821.5-2272s21c1
Sequence:GTACCGGACTTGTCTAAGATGCAATTTGCTCGAGCAAATTGCATCTTAGACAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003821.5-2364s21c1
Sequence:CCGGTTGCCCTACAAAGGGTTATTACTCGAGTAATAACCCTTTGTAGGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003821.5-604s21c1
Sequence:GTACCGGACATGCCAAATGGATCATTAACTCGAGTTAATGATCCATTTGGCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003821.5-2017s1c1
Sequence:CCGGCCGTGAGTATTAAAGCTTTATCTCGAGATAAAGCTTTAATACTCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003821.5-1010s21c1
Sequence:GTACCGGCACCAATCCTTTGCAGATAATCTCGAGATTATCTGCAAAGGATTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003821.5-1047s21c1
Sequence:GTACCGGGGACATCGACCTGTTATTAATCTCGAGATTAATAACAGGTCGATGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003821.5-931s21c1
Sequence:CCGGCCAGTATCAAGCACGATATATCTCGAGATATATCGTGCTTGATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003821.5-1864s21c1
Sequence:GTACCGGTTCAGCCTTACCCGGAAATACCTCGAGGTATTTCCGGGTAAGGCTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003821.5-841s21c1
Sequence:GTACCGGCACAGTCACGAAGTAGCAAATCTCGAGATTTGCTACTTCGTGACTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003821.4-2291s1c1
Sequence:CCGGCCAGGCTTAATTGCCCTACAACTCGAGTTGTAGGGCAATTAAGCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003821.5-2269s1c1
Sequence:CCGGGTTACTTGTCTAAGATGCAATCTCGAGATTGCATCTTAGACAAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003821.4-867s1c1
Sequence:CCGGGCCAGTATCAAGCACGATATACTCGAGTATATCGTGCTTGATACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003821.4-656s1c1
Sequence:CCGGGCACAATATGACTCCTCCTTTCTCGAGAAAGGAGGAGTCATATTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003821.4-1438s1c1
Sequence:CCGGGCACCATTTCTGGATCTCAAACTCGAGTTTGAGATCCAGAAATGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003821.4-1164s1c1
Sequence:CCGGGCTGTTATTCAGCTAAAGAAACTCGAGTTTCTTTAGCTGAATAACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003821
VALIDATED
RIPK2 MISSION shRNA Lentiviral Transduction Particles
receptor-interacting serine-threonine kinase 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003821.5-2272s21c1
Sequence:GTACCGGACTTGTCTAAGATGCAATTTGCTCGAGCAAATTGCATCTTAGACAAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003821.5-2364s21c1
Sequence:CCGGTTGCCCTACAAAGGGTTATTACTCGAGTAATAACCCTTTGTAGGGCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003821.5-604s21c1
Sequence:GTACCGGACATGCCAAATGGATCATTAACTCGAGTTAATGATCCATTTGGCATGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003821.5-2017s1c1
Sequence:CCGGCCGTGAGTATTAAAGCTTTATCTCGAGATAAAGCTTTAATACTCACGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003821.5-1010s21c1
Sequence:GTACCGGCACCAATCCTTTGCAGATAATCTCGAGATTATCTGCAAAGGATTGGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003821.5-1047s21c1
Sequence:GTACCGGGGACATCGACCTGTTATTAATCTCGAGATTAATAACAGGTCGATGTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003821.5-931s21c1
Sequence:CCGGCCAGTATCAAGCACGATATATCTCGAGATATATCGTGCTTGATACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003821.5-1864s21c1
Sequence:GTACCGGTTCAGCCTTACCCGGAAATACCTCGAGGTATTTCCGGGTAAGGCTGAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003821.5-841s21c1
Sequence:GTACCGGCACAGTCACGAAGTAGCAAATCTCGAGATTTGCTACTTCGTGACTGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003821.4-2291s1c1
Sequence:CCGGCCAGGCTTAATTGCCCTACAACTCGAGTTGTAGGGCAATTAAGCCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196814    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003821.5-2269s1c1
Sequence:CCGGGTTACTTGTCTAAGATGCAATCTCGAGATTGCATCTTAGACAAGTAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003821.4-867s1c1
Sequence:CCGGGCCAGTATCAAGCACGATATACTCGAGTATATCGTGCTTGATACTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003821.4-656s1c1
Sequence:CCGGGCACAATATGACTCCTCCTTTCTCGAGAAAGGAGGAGTCATATTGTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003821.4-1438s1c1
Sequence:CCGGGCACCATTTCTGGATCTCAAACTCGAGTTTGAGATCCAGAAATGGTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003821.4-1164s1c1
Sequence:CCGGGCTGTTATTCAGCTAAAGAAACTCGAGTTTCTTTAGCTGAATAACAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138952
VALIDATED
RIPK2 MISSION shRNA Bacterial Glycerol Stock
receptor-interacting serine-threonine kinase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138952.3-614s21c1
Sequence:CCGGGCATGATGTCACTCTCTCAATCTCGAGATTGAGAGAGTGACATCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138952.3-270s21c1
Sequence:CCGGCGACAGTGAAAGAAATGATATCTCGAGATATCATTTCTTTCACTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138952.3-391s21c1
Sequence:CCGGTACATGCCAAATGGATCATTACTCGAGTAATGATCCATTTGGCATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138952.3-718s21c1
Sequence:CCGGGCCAGTGTGAAGCATGATATACTCGAGTATATCATGCTTCACACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138952.1-512s1c1
Sequence:CCGGGCATGATGTCACTCTCTCAATCTCGAGATTGAGAGAGTGACATCATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138952.1-1464s1c1
Sequence:CCGGGCTGCTAGATACGTCTGACATCTCGAGATGTCAGACGTATCTAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138952.1-616s1c1
Sequence:CCGGGCCAGTGTGAAGCATGATATACTCGAGTATATCATGCTTCACACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138952.1-168s1c1
Sequence:CCGGCGACAGTGAAAGAAATGATATCTCGAGATATCATTTCTTTCACTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138952.1-829s1c1
Sequence:CCGGCCAGATGAAAGACCATCCTTTCTCGAGAAAGGATGGTCTTTCATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138952
VALIDATED
RIPK2 MISSION shRNA shRNA Plasmid DNA
receptor-interacting serine-threonine kinase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138952.3-614s21c1
Sequence:CCGGGCATGATGTCACTCTCTCAATCTCGAGATTGAGAGAGTGACATCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138952.3-270s21c1
Sequence:CCGGCGACAGTGAAAGAAATGATATCTCGAGATATCATTTCTTTCACTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138952.3-391s21c1
Sequence:CCGGTACATGCCAAATGGATCATTACTCGAGTAATGATCCATTTGGCATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138952.3-718s21c1
Sequence:CCGGGCCAGTGTGAAGCATGATATACTCGAGTATATCATGCTTCACACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138952.1-512s1c1
Sequence:CCGGGCATGATGTCACTCTCTCAATCTCGAGATTGAGAGAGTGACATCATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138952.1-1464s1c1
Sequence:CCGGGCTGCTAGATACGTCTGACATCTCGAGATGTCAGACGTATCTAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138952.1-616s1c1
Sequence:CCGGGCCAGTGTGAAGCATGATATACTCGAGTATATCATGCTTCACACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138952.1-168s1c1
Sequence:CCGGCGACAGTGAAAGAAATGATATCTCGAGATATCATTTCTTTCACTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138952.1-829s1c1
Sequence:CCGGCCAGATGAAAGACCATCCTTTCTCGAGAAAGGATGGTCTTTCATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138952
VALIDATED
RIPK2 MISSION shRNA Lentiviral Transduction Particles
receptor-interacting serine-threonine kinase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138952.3-614s21c1
Sequence:CCGGGCATGATGTCACTCTCTCAATCTCGAGATTGAGAGAGTGACATCATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138952.3-270s21c1
Sequence:CCGGCGACAGTGAAAGAAATGATATCTCGAGATATCATTTCTTTCACTGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138952.3-391s21c1
Sequence:CCGGTACATGCCAAATGGATCATTACTCGAGTAATGATCCATTTGGCATGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138952.3-718s21c1
Sequence:CCGGGCCAGTGTGAAGCATGATATACTCGAGTATATCATGCTTCACACTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138952.1-512s1c1
Sequence:CCGGGCATGATGTCACTCTCTCAATCTCGAGATTGAGAGAGTGACATCATGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138952.1-1464s1c1
Sequence:CCGGGCTGCTAGATACGTCTGACATCTCGAGATGTCAGACGTATCTAGCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138952.1-616s1c1
Sequence:CCGGGCCAGTGTGAAGCATGATATACTCGAGTATATCATGCTTCACACTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138952.1-168s1c1
Sequence:CCGGCGACAGTGAAAGAAATGATATCTCGAGATATCATTTCTTTCACTGTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138952.1-829s1c1
Sequence:CCGGCCAGATGAAAGACCATCCTTTCTCGAGAAAGGATGGTCTTTCATCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)