EMAIL THIS PAGE TO A FRIEND

RIPK3

receptor-interacting serine-threonine kinase 3

77 Gene Product Result for
Synonyms: RIP3
UniProtKB ID: Q9Y572, B4DJL9, C4AM87, Q5J795, Q5J796, Q6P5Y1
Gene ID:
Human(11035) Summary: The product of this gene is a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases, and contains a C-terminal domain unique from other RIP family members. The encoded protein is predominantly localized to the cytoplasm, and can undergo nucleocytoplasmic shuttling dependent on novel nuclear localization and export signals. It is a component of the tumor necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor. [provided by RefSeq, Jul 2008]
Mouse(56532) receptor-interacting serine-threonine kinase 3
Rat(246240) receptor-interacting serine-threonine kinase 3
cow(507427) receptor-interacting serine-threonine kinase 3
sheep(101118877) receptor-interacting serine-threonine kinase 3
domestic guinea pig(100734737) receptor-interacting serine-threonine kinase 3
naked mole-rat(101719112) receptor-interacting serine-threonine kinase 3
dog(608486) receptor-interacting serine-threonine kinase 3
domestic cat(101097985) receptor-interacting serine-threonine kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
R4277 Anti-RIP3 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution rat, human, mouse
western blot pricing
PRS2283 Anti-RIP3 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2108462 Anti-RIPK3 IgG fraction of antiserum rat, pig, horse, canine, mouse, human, bovine
immunohistochemistry, western blot pricing
SAB2108206 Anti-RIPK3 antibody produced in rabbit affinity isolated antibody rat, human, horse, mouse, bovine
western blot pricing
AV31513 Anti-RIPK3 antibody produced in rabbit IgG fraction of antiserum mouse, horse, pig, bovine, canine, human, rat
immunohistochemistry, western blot pricing
SAB2102009 Anti-RIPK3 antibody produced in rabbit affinity isolated antibody, lyophilized powder bovine, human, rat, mouse, horse
western blot pricing
SAB2103903 Anti-RIPK3 antibody produced in rabbit affinity isolated antibody rat, canine, bovine, human, horse
western blot pricing
HPA054606 Anti-RIPK3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA055087 Anti-RIPK3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006871 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006871 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006871 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019955 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019955 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019955 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006871 Rosetta Predictions human pricing
NM_139342 Rosetta Predictions rat pricing
NM_019955 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078750 predicted 366
2 SASI_Hs01_00078752 predicted 1588
3 SASI_Hs01_00078753 predicted 1194
4 SASI_Hs01_00078754 predicted 486
5 SASI_Hs01_00078756 predicted 1614
6 SASI_Hs01_00078757 predicted 769
7 SASI_Hs01_00078758 predicted 1554
8 SASI_Hs01_00078759 predicted 976
9 SASI_Hs02_00342510 predicted 351
10 SASI_Hs02_00342511 predicted 1220
11 SASI_Hs01_00078751 predicted 1181
12 SASI_Hs01_00078755 predicted 1226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139342 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268605 predicted 1360
2 SASI_Rn02_00268606 predicted 688
3 SASI_Rn01_00116575 predicted 892
4 SASI_Rn01_00116576 predicted 1297
5 SASI_Rn01_00116577 predicted 1508
6 SASI_Rn01_00116578 predicted 889
7 SASI_Rn01_00116579 predicted 943
8 SASI_Rn01_00116581 predicted 1764
9 SASI_Rn01_00116582 predicted 474
10 SASI_Rn01_00116583 predicted 1748
11 SASI_Rn01_00116574 predicted 647
12 SASI_Rn01_00116580 predicted 1394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019955 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105473 predicted 1100
2 SASI_Mm01_00105475 predicted 1066
3 SASI_Mm01_00105476 predicted 1540
4 SASI_Mm01_00105477 predicted 1010
5 SASI_Mm01_00105478 predicted 1056
6 SASI_Mm02_00325249 predicted 1385
7 SASI_Mm01_00105479 predicted 751
8 SASI_Mm01_00105480 predicted 337
9 SASI_Mm01_00105481 predicted 294
10 SASI_Mm01_00105482 predicted 825
11 SASI_Mm01_00105474 predicted 347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006871
RIPK3 MISSION shRNA Bacterial Glycerol Stock
receptor-interacting serine-threonine kinase 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006871.3-1594s1c1
Sequence:CCGGGACAACAACTACTTGACTATGCTCGAGCATAGTCAAGTAGTTGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006871.3-775s1c1
Sequence:CCGGGAACTGTTTGTTAACGTAAACCTCGAGGTTTACGTTAACAAACAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006871.x-1280s1c1
Sequence:CCGGCTGAGAGACAAGGCATGAACTCTCGAGAGTTCATGCCTTGTCTCTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006871.x-1011s1c1
Sequence:CCGGGCACTCTCGTAATGATGTCATCTCGAGATGACATCATTACGAGAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006871.x-612s1c1
Sequence:CCGGCTACAGCTTCGGGATCCTAATCTCGAGATTAGGATCCCGAAGCTGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006871.3-1732s21c1
Sequence:CCGGAGGCCACAGGGTTGGTATAATCTCGAGATTATACCAACCCTGTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006871.3-1694s21c1
Sequence:CCGGGTTCGCAAGAAGGCCCTAAAGCTCGAGCTTTAGGGCCTTCTTGCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006871.3-1547s21c1
Sequence:CCGGGGCGACCGCTCGTTAACATATCTCGAGATATGTTAACGAGCGGTCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006871.3-477s21c1
Sequence:CCGGGCCGGCTCTGGTGACTAAATTCTCGAGAATTTAGTCACCAGAGCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006871.3-362s21c1
Sequence:CCGGTCGTAAACTCGAAGGCGATATCTCGAGATATCGCCTTCGAGTTTACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006871
RIPK3 MISSION shRNA shRNA Plasmid DNA
receptor-interacting serine-threonine kinase 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006871.3-1594s1c1
Sequence:CCGGGACAACAACTACTTGACTATGCTCGAGCATAGTCAAGTAGTTGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006871.3-775s1c1
Sequence:CCGGGAACTGTTTGTTAACGTAAACCTCGAGGTTTACGTTAACAAACAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006871.x-1280s1c1
Sequence:CCGGCTGAGAGACAAGGCATGAACTCTCGAGAGTTCATGCCTTGTCTCTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006871.x-1011s1c1
Sequence:CCGGGCACTCTCGTAATGATGTCATCTCGAGATGACATCATTACGAGAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006871.x-612s1c1
Sequence:CCGGCTACAGCTTCGGGATCCTAATCTCGAGATTAGGATCCCGAAGCTGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006871.3-1732s21c1
Sequence:CCGGAGGCCACAGGGTTGGTATAATCTCGAGATTATACCAACCCTGTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006871.3-1694s21c1
Sequence:CCGGGTTCGCAAGAAGGCCCTAAAGCTCGAGCTTTAGGGCCTTCTTGCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006871.3-1547s21c1
Sequence:CCGGGGCGACCGCTCGTTAACATATCTCGAGATATGTTAACGAGCGGTCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006871.3-477s21c1
Sequence:CCGGGCCGGCTCTGGTGACTAAATTCTCGAGAATTTAGTCACCAGAGCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006871.3-362s21c1
Sequence:CCGGTCGTAAACTCGAAGGCGATATCTCGAGATATCGCCTTCGAGTTTACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006871
RIPK3 MISSION shRNA Lentiviral Transduction Particles
receptor-interacting serine-threonine kinase 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006871.3-1594s1c1
Sequence:CCGGGACAACAACTACTTGACTATGCTCGAGCATAGTCAAGTAGTTGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006871.3-775s1c1
Sequence:CCGGGAACTGTTTGTTAACGTAAACCTCGAGGTTTACGTTAACAAACAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006871.x-1280s1c1
Sequence:CCGGCTGAGAGACAAGGCATGAACTCTCGAGAGTTCATGCCTTGTCTCTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006871.x-1011s1c1
Sequence:CCGGGCACTCTCGTAATGATGTCATCTCGAGATGACATCATTACGAGAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006871.x-612s1c1
Sequence:CCGGCTACAGCTTCGGGATCCTAATCTCGAGATTAGGATCCCGAAGCTGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006871.3-1732s21c1
Sequence:CCGGAGGCCACAGGGTTGGTATAATCTCGAGATTATACCAACCCTGTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006871.3-1694s21c1
Sequence:CCGGGTTCGCAAGAAGGCCCTAAAGCTCGAGCTTTAGGGCCTTCTTGCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006871.3-1547s21c1
Sequence:CCGGGGCGACCGCTCGTTAACATATCTCGAGATATGTTAACGAGCGGTCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006871.3-477s21c1
Sequence:CCGGGCCGGCTCTGGTGACTAAATTCTCGAGAATTTAGTCACCAGAGCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006871.3-362s21c1
Sequence:CCGGTCGTAAACTCGAAGGCGATATCTCGAGATATCGCCTTCGAGTTTACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019955
RIPK3 MISSION shRNA Bacterial Glycerol Stock
receptor-interacting serine-threonine kinase 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019955.1-766s1c1
Sequence:CCGGGCGAGTGATGTCTACAGCTTTCTCGAGAAAGCTGTAGACATCACTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019955.1-1309s1c1
Sequence:CCGGCCTCAGATTCCACATACTTTACTCGAGTAAAGTATGTGGAATCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019955.1-340s1c1
Sequence:CCGGGCTATGGTTAATCTTCGTAATCTCGAGATTACGAAGATTAACCATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019955.1-1497s1c1
Sequence:CCGGGATTGGGAACTACAACTCCTTCTCGAGAAGGAGTTGTAGTTCCCAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019955.1-586s1c1
Sequence:CCGGCCCTCTAACATTCTGCTGGATCTCGAGATCCAGCAGAATGTTAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019955.2-1010s21c1
Sequence:CCGGGAAGGAGTTAATGATTCATTGCTCGAGCAATGAATCATTAACTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019955.2-1716s21c1
Sequence:CCGGGCCATTCAGCGTGGCAATAAACTCGAGTTTATTGCCACGCTGAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019955.2-1414s21c1
Sequence:CCGGCAACACCTGGGCCAGTCTTTACTCGAGTAAAGACTGGCCCAGGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019955.2-686s21c1
Sequence:CCGGCCACGCCAAGCTAGCAGATTTCTCGAGAAATCTGCTAGCTTGGCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019955
RIPK3 MISSION shRNA shRNA Plasmid DNA
receptor-interacting serine-threonine kinase 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019955.1-766s1c1
Sequence:CCGGGCGAGTGATGTCTACAGCTTTCTCGAGAAAGCTGTAGACATCACTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019955.1-1309s1c1
Sequence:CCGGCCTCAGATTCCACATACTTTACTCGAGTAAAGTATGTGGAATCTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019955.1-340s1c1
Sequence:CCGGGCTATGGTTAATCTTCGTAATCTCGAGATTACGAAGATTAACCATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019955.1-1497s1c1
Sequence:CCGGGATTGGGAACTACAACTCCTTCTCGAGAAGGAGTTGTAGTTCCCAATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019955.1-586s1c1
Sequence:CCGGCCCTCTAACATTCTGCTGGATCTCGAGATCCAGCAGAATGTTAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019955.2-1010s21c1
Sequence:CCGGGAAGGAGTTAATGATTCATTGCTCGAGCAATGAATCATTAACTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019955.2-1716s21c1
Sequence:CCGGGCCATTCAGCGTGGCAATAAACTCGAGTTTATTGCCACGCTGAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019955.2-1414s21c1
Sequence:CCGGCAACACCTGGGCCAGTCTTTACTCGAGTAAAGACTGGCCCAGGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019955.2-686s21c1
Sequence:CCGGCCACGCCAAGCTAGCAGATTTCTCGAGAAATCTGCTAGCTTGGCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019955
RIPK3 MISSION shRNA Lentiviral Transduction Particles
receptor-interacting serine-threonine kinase 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019955.1-766s1c1
Sequence:CCGGGCGAGTGATGTCTACAGCTTTCTCGAGAAAGCTGTAGACATCACTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019955.1-1309s1c1
Sequence:CCGGCCTCAGATTCCACATACTTTACTCGAGTAAAGTATGTGGAATCTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019955.1-340s1c1
Sequence:CCGGGCTATGGTTAATCTTCGTAATCTCGAGATTACGAAGATTAACCATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019955.1-1497s1c1
Sequence:CCGGGATTGGGAACTACAACTCCTTCTCGAGAAGGAGTTGTAGTTCCCAATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019955.1-586s1c1
Sequence:CCGGCCCTCTAACATTCTGCTGGATCTCGAGATCCAGCAGAATGTTAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019955.2-1010s21c1
Sequence:CCGGGAAGGAGTTAATGATTCATTGCTCGAGCAATGAATCATTAACTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019955.2-1716s21c1
Sequence:CCGGGCCATTCAGCGTGGCAATAAACTCGAGTTTATTGCCACGCTGAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019955.2-1414s21c1
Sequence:CCGGCAACACCTGGGCCAGTCTTTACTCGAGTAAAGACTGGCCCAGGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019955.2-686s21c1
Sequence:CCGGCCACGCCAAGCTAGCAGATTTCTCGAGAAATCTGCTAGCTTGGCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)