EMAIL THIS PAGE TO A FRIEND

RIT1

Ras-like without CAAX 1

49 Gene Product Result for
Synonyms: NS8 RIBB RIT ROC1
UniProtKB ID: Q92963, B4DQE8, O00646, O00720, Q5VY89, Q5VY90
Gene ID:
Human(6016) Summary: This gene encodes a member of a subfamily of Ras-related GTPases. The encoded protein is involved in regulating p38 MAPK-dependent signaling cascades related to cellular stress. This protein also cooperates with nerve growth factor to promote neuronal development and regeneration. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
Mouse(19769) Ras-like without CAAX 1
Rat(499652) Ras-like without CAAX 1
cow(533646) Ras-like without CAAX 1
sheep(100145877) Ras-like without CAAX 1
naked mole-rat(101697370) Ras-like without CAAX 1
domestic guinea pig(100718792) Ras-like without CAAX 1
Zebrafish(793942) Ras-like without CAAX 1
dog(480126) Ras-like without CAAX 1
domestic cat(101085597) Ras-like without CAAX 1
chicken(425068) Ras-like without CAAX 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009069 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009069 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009069 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006912 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006912 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006912 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006912 Rosetta Predictions human pricing
NM_001109185 Rosetta Predictions rat pricing
NM_009069 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081304 predicted 915
2 SASI_Hs01_00081305 predicted 892
3 SASI_Hs02_00342588 predicted 685
4 SASI_Hs01_00081307 predicted 558
5 SASI_Hs01_00081308 predicted 341
6 SASI_Hs01_00081309 predicted 474
7 SASI_Hs01_00081310 predicted 481
8 SASI_Hs01_00081311 predicted 601
9 SASI_Hs01_00081313 predicted 408
10 SASI_Hs02_00342589 predicted 366
11 SASI_Hs01_00081306 predicted 793
12 SASI_Hs01_00081312 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245960 predicted 896
2 SASI_Rn02_00245961 predicted 475
3 SASI_Rn02_00245962 predicted 484
4 SASI_Rn02_00245963 predicted 876
5 SASI_Rn02_00245964 predicted 653
6 SASI_Rn02_00245965 predicted 950
7 SASI_Rn02_00245966 predicted 948
8 SASI_Rn02_00245967 predicted 646
9 SASI_Rn02_00245968 predicted 250
10 SASI_Rn02_00245969 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009069 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315244 predicted 379
2 SASI_Mm01_00127137 predicted 451
3 SASI_Mm01_00127138 predicted 225
4 SASI_Mm01_00127139 predicted 627
5 SASI_Mm01_00127140 predicted 948
6 SASI_Mm01_00127141 predicted 901
7 SASI_Mm01_00127142 predicted 461
8 SASI_Mm01_00127144 predicted 329
9 SASI_Mm02_00315245 predicted 952
10 SASI_Mm01_00127145 predicted 200
11 SASI_Mm01_00127143 predicted 455
12 SASI_Mm01_00127146 predicted 296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009069
VALIDATED
RIT1 MISSION shRNA Bacterial Glycerol Stock
Ras-like without CAAX 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009069.3-446s21c1
Sequence:CCGGCGTCGAAGTTTCCACGAAGTTCTCGAGAACTTCGTGGAAACTTCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009069.3-905s21c1
Sequence:CCGGCTGCTATGTGGTTATTCTAAACTCGAGTTTAGAATAACCACATAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009069.3-381s21c1
Sequence:CCGGCAGCCATGCGGGATCAGTATACTCGAGTATACTGATCCCGCATGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009069.2-447s1c1
Sequence:CCGGCGTCGAAGTTTCCACGAAGTTCTCGAGAACTTCGTGGAAACTTCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009069.2-901s1c1
Sequence:CCGGGCTCTCTGCTATGTGGTTATTCTCGAGAATAACCACATAGCAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009069.2-468s1c1
Sequence:CCGGCGGGAGTTTAAACAACTGATTCTCGAGAATCAGTTGTTTAAACTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009069.2-636s1c1
Sequence:CCGGCGTTACTACATCGACGACGTTCTCGAGAACGTCGTCGATGTAGTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009069.3-470s21c1
Sequence:CCGGGAGTTTAAACAACTGATTTACCTCGAGGTAAATCAGTTGTTTAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009069.3-290s21c1
Sequence:CCGGACCATTGAAGATGCTTATAAGCTCGAGCTTATAAGCATCTTCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009069.2-288s1c1
Sequence:CCGGCCCACCATTGAAGATGCTTATCTCGAGATAAGCATCTTCAATGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009069
VALIDATED
RIT1 MISSION shRNA shRNA Plasmid DNA
Ras-like without CAAX 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009069.3-446s21c1
Sequence:CCGGCGTCGAAGTTTCCACGAAGTTCTCGAGAACTTCGTGGAAACTTCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009069.3-905s21c1
Sequence:CCGGCTGCTATGTGGTTATTCTAAACTCGAGTTTAGAATAACCACATAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009069.3-381s21c1
Sequence:CCGGCAGCCATGCGGGATCAGTATACTCGAGTATACTGATCCCGCATGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009069.2-447s1c1
Sequence:CCGGCGTCGAAGTTTCCACGAAGTTCTCGAGAACTTCGTGGAAACTTCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009069.2-901s1c1
Sequence:CCGGGCTCTCTGCTATGTGGTTATTCTCGAGAATAACCACATAGCAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009069.2-468s1c1
Sequence:CCGGCGGGAGTTTAAACAACTGATTCTCGAGAATCAGTTGTTTAAACTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009069.2-636s1c1
Sequence:CCGGCGTTACTACATCGACGACGTTCTCGAGAACGTCGTCGATGTAGTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009069.3-470s21c1
Sequence:CCGGGAGTTTAAACAACTGATTTACCTCGAGGTAAATCAGTTGTTTAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009069.3-290s21c1
Sequence:CCGGACCATTGAAGATGCTTATAAGCTCGAGCTTATAAGCATCTTCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009069.2-288s1c1
Sequence:CCGGCCCACCATTGAAGATGCTTATCTCGAGATAAGCATCTTCAATGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009069
VALIDATED
RIT1 MISSION shRNA Lentiviral Transduction Particles
Ras-like without CAAX 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009069.3-446s21c1
Sequence:CCGGCGTCGAAGTTTCCACGAAGTTCTCGAGAACTTCGTGGAAACTTCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009069.3-905s21c1
Sequence:CCGGCTGCTATGTGGTTATTCTAAACTCGAGTTTAGAATAACCACATAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009069.3-381s21c1
Sequence:CCGGCAGCCATGCGGGATCAGTATACTCGAGTATACTGATCCCGCATGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009069.2-447s1c1
Sequence:CCGGCGTCGAAGTTTCCACGAAGTTCTCGAGAACTTCGTGGAAACTTCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009069.2-901s1c1
Sequence:CCGGGCTCTCTGCTATGTGGTTATTCTCGAGAATAACCACATAGCAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009069.2-468s1c1
Sequence:CCGGCGGGAGTTTAAACAACTGATTCTCGAGAATCAGTTGTTTAAACTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009069.2-636s1c1
Sequence:CCGGCGTTACTACATCGACGACGTTCTCGAGAACGTCGTCGATGTAGTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009069.3-470s21c1
Sequence:CCGGGAGTTTAAACAACTGATTTACCTCGAGGTAAATCAGTTGTTTAAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009069.3-290s21c1
Sequence:CCGGACCATTGAAGATGCTTATAAGCTCGAGCTTATAAGCATCTTCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009069.2-288s1c1
Sequence:CCGGCCCACCATTGAAGATGCTTATCTCGAGATAAGCATCTTCAATGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006912
VALIDATED
RIT1 MISSION shRNA Bacterial Glycerol Stock
Ras-like without CAAX 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006912.4-1087s21c1
Sequence:CCGGTGGGTTCTGTTGCGCTATTAACTCGAGTTAATAGCGCAACAGAACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006912.4-714s21c1
Sequence:CCGGATGCCCTTGTACGGGAGATACCTCGAGGTATCTCCCGTACAAGGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006912.2-605s1c1
Sequence:CCGGCGAGAATTCAGCTGTCCCTTTCTCGAGAAAGGGACAGCTGAATTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006912.2-287s1c1
Sequence:CCGGGAAGATCATGATCCCACCATTCTCGAGAATGGTGGGATCATGATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006912.2-647s1c1
Sequence:CCGGCGCTACTATATTGATGATGTTCTCGAGAACATCATCAATATAGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006912.2-458s1c1
Sequence:CCGGCGTCGAAGTTTCCATGAAGTTCTCGAGAACTTCATGGAAACTTCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006912.4-360s21c1
Sequence:CCGGATAAGATCAGGATCCGTATTGCTCGAGCAATACGGATCCTGATCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006912.4-500s21c1
Sequence:CCGGCGTCGAAGTTTCCATGAAGTTCTCGAGAACTTCATGGAAACTTCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006912.4-457s21c1
Sequence:CCGGGAGGGCAGGAGAAGGGTTTATCTCGAGATAAACCCTTCTCCTGCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006912.4-680s21c1
Sequence:CCGGGCTGCATACCGCTACTATATTCTCGAGAATATAGTAGCGGTATGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006912.2-748s1c1
Sequence:CCGGCAGTGTATGGAAGAGGCTAAACTCGAGTTTAGCCTCTTCCATACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006912
VALIDATED
RIT1 MISSION shRNA shRNA Plasmid DNA
Ras-like without CAAX 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006912.4-1087s21c1
Sequence:CCGGTGGGTTCTGTTGCGCTATTAACTCGAGTTAATAGCGCAACAGAACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006912.4-714s21c1
Sequence:CCGGATGCCCTTGTACGGGAGATACCTCGAGGTATCTCCCGTACAAGGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006912.2-605s1c1
Sequence:CCGGCGAGAATTCAGCTGTCCCTTTCTCGAGAAAGGGACAGCTGAATTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006912.2-287s1c1
Sequence:CCGGGAAGATCATGATCCCACCATTCTCGAGAATGGTGGGATCATGATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006912.2-647s1c1
Sequence:CCGGCGCTACTATATTGATGATGTTCTCGAGAACATCATCAATATAGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006912.2-458s1c1
Sequence:CCGGCGTCGAAGTTTCCATGAAGTTCTCGAGAACTTCATGGAAACTTCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006912.4-360s21c1
Sequence:CCGGATAAGATCAGGATCCGTATTGCTCGAGCAATACGGATCCTGATCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006912.4-500s21c1
Sequence:CCGGCGTCGAAGTTTCCATGAAGTTCTCGAGAACTTCATGGAAACTTCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006912.4-457s21c1
Sequence:CCGGGAGGGCAGGAGAAGGGTTTATCTCGAGATAAACCCTTCTCCTGCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006912.4-680s21c1
Sequence:CCGGGCTGCATACCGCTACTATATTCTCGAGAATATAGTAGCGGTATGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006912.2-748s1c1
Sequence:CCGGCAGTGTATGGAAGAGGCTAAACTCGAGTTTAGCCTCTTCCATACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006912
VALIDATED
RIT1 MISSION shRNA Lentiviral Transduction Particles
Ras-like without CAAX 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006912.4-1087s21c1
Sequence:CCGGTGGGTTCTGTTGCGCTATTAACTCGAGTTAATAGCGCAACAGAACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006912.4-714s21c1
Sequence:CCGGATGCCCTTGTACGGGAGATACCTCGAGGTATCTCCCGTACAAGGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006912.2-605s1c1
Sequence:CCGGCGAGAATTCAGCTGTCCCTTTCTCGAGAAAGGGACAGCTGAATTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006912.2-287s1c1
Sequence:CCGGGAAGATCATGATCCCACCATTCTCGAGAATGGTGGGATCATGATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006912.2-647s1c1
Sequence:CCGGCGCTACTATATTGATGATGTTCTCGAGAACATCATCAATATAGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006912.2-458s1c1
Sequence:CCGGCGTCGAAGTTTCCATGAAGTTCTCGAGAACTTCATGGAAACTTCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006912.4-360s21c1
Sequence:CCGGATAAGATCAGGATCCGTATTGCTCGAGCAATACGGATCCTGATCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006912.4-500s21c1
Sequence:CCGGCGTCGAAGTTTCCATGAAGTTCTCGAGAACTTCATGGAAACTTCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006912.4-457s21c1
Sequence:CCGGGAGGGCAGGAGAAGGGTTTATCTCGAGATAAACCCTTCTCCTGCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006912.4-680s21c1
Sequence:CCGGGCTGCATACCGCTACTATATTCTCGAGAATATAGTAGCGGTATGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006912.2-748s1c1
Sequence:CCGGCAGTGTATGGAAGAGGCTAAACTCGAGTTTAGCCTCTTCCATACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)