EMAIL THIS PAGE TO A FRIEND

RLBP1

retinaldehyde binding protein 1

55 Gene Product Result for
Synonyms: CRALBP
UniProtKB ID: P12271, B2R667
Gene ID:
Human(6017) Summary: The protein encoded by this gene is a 36-kD water-soluble protein which carries 11-cis-retinaldehyde or 11-cis-retinal as physiologic ligands. It may be a functional component of the visual cycle. Mutations of this gene have been associated with severe rod-cone dystrophy, Bothnia dystrophy (nonsyndromic autosomal recessive retinitis pigmentosa) and retinitis punctata albescens. [provided by RefSeq, Jul 2008]
Mouse(19771) retinaldehyde binding protein 1
Rat(293049) retinaldehyde binding protein 1
chicken(415492) retinaldehyde binding protein 1
dog(479039) retinaldehyde binding protein 1
domestic cat(101084031) retinaldehyde binding protein 1
naked mole-rat(101699581) retinaldehyde binding protein 1
domestic guinea pig(100729190) retinaldehyde binding protein 1
cow(282038) retinaldehyde binding protein 1
sheep(101103269) retinaldehyde binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000326 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020599 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020599 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020599 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000326 Rosetta Predictions human pricing
NM_001106274 Rosetta Predictions rat pricing
NM_020599 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120907 predicted 1315
2 SASI_Hs01_00120908 predicted 1459
3 SASI_Hs01_00120909 predicted 666
4 SASI_Hs01_00120910 predicted 892
5 SASI_Hs01_00120911 predicted 743
6 SASI_Hs02_00302338 predicted 672
7 SASI_Hs01_00120912 predicted 1017
8 SASI_Hs01_00120913 predicted 1111
9 SASI_Hs01_00120914 predicted 522
10 SASI_Hs01_00120915 predicted 458
11 SASI_Hs01_00120906 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106274 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217358 predicted 1017
2 SASI_Rn02_00217359 predicted 1066
3 SASI_Rn02_00217360 predicted 1446
4 SASI_Rn02_00217361 predicted 686
5 SASI_Rn02_00217362 predicted 1293
6 SASI_Rn02_00217363 predicted 641
7 SASI_Rn02_00217364 predicted 1076
8 SASI_Rn02_00217365 predicted 1265
9 SASI_Rn02_00217366 predicted 932
10 SASI_Rn02_00217367 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091198 predicted 672
2 SASI_Mm01_00091199 predicted 732
3 SASI_Mm01_00091200 predicted 918
4 SASI_Mm01_00091201 predicted 309
5 SASI_Mm01_00091202 predicted 1106
6 SASI_Mm01_00091203 predicted 740
7 SASI_Mm01_00091204 predicted 1030
8 SASI_Mm01_00091205 predicted 546
9 SASI_Mm01_00091206 predicted 686
10 SASI_Mm02_00325697 predicted 599
11 SASI_Mm01_00091207 predicted 962
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000326
RLBP1 MISSION shRNA Bacterial Glycerol Stock
retinaldehyde binding protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000326.4-463s21c1
Sequence:CCGGAGGACCATGGACCTGTCTTTGCTCGAGCAAAGACAGGTCCATGGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000326.4-1556s21c1
Sequence:CCGGCACCTGCCCTTGAAGCTTTAACTCGAGTTAAAGCTTCAAGGGCAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000326.4-823s21c1
Sequence:CCGGTCTCTAGTCGGGACAAGTATGCTCGAGCATACTTGTCCCGACTAGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000326.4-1349s21c1
Sequence:CCGGAGCTGAACTGTAGTTAGAATCCTCGAGGATTCTAACTACAGTTCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000326.3-878s1c1
Sequence:CCGGGCAAAGTCAAGAAATCACCTTCTCGAGAAGGTGATTTCTTGACTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000326.3-971s1c1
Sequence:CCGGCTTCTGCATCATTGAGAACTTCTCGAGAAGTTCTCAATGATGCAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000326.3-1124s1c1
Sequence:CCGGCACGACCTACAATGTGGTCAACTCGAGTTGACCACATTGTAGGTCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000326.3-1256s1c1
Sequence:CCGGGCTGCCCAAGTATGATGGCAACTCGAGTTGCCATCATACTTGGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000326.3-719s1c1
Sequence:CCGGGCTCAGAGGCTATGTGAATTTCTCGAGAAATTCACATAGCCTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000326
RLBP1 MISSION shRNA shRNA Plasmid DNA
retinaldehyde binding protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000326.4-463s21c1
Sequence:CCGGAGGACCATGGACCTGTCTTTGCTCGAGCAAAGACAGGTCCATGGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000326.4-1556s21c1
Sequence:CCGGCACCTGCCCTTGAAGCTTTAACTCGAGTTAAAGCTTCAAGGGCAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000326.4-823s21c1
Sequence:CCGGTCTCTAGTCGGGACAAGTATGCTCGAGCATACTTGTCCCGACTAGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000326.4-1349s21c1
Sequence:CCGGAGCTGAACTGTAGTTAGAATCCTCGAGGATTCTAACTACAGTTCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000326.3-878s1c1
Sequence:CCGGGCAAAGTCAAGAAATCACCTTCTCGAGAAGGTGATTTCTTGACTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000326.3-971s1c1
Sequence:CCGGCTTCTGCATCATTGAGAACTTCTCGAGAAGTTCTCAATGATGCAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000326.3-1124s1c1
Sequence:CCGGCACGACCTACAATGTGGTCAACTCGAGTTGACCACATTGTAGGTCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000326.3-1256s1c1
Sequence:CCGGGCTGCCCAAGTATGATGGCAACTCGAGTTGCCATCATACTTGGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000326.3-719s1c1
Sequence:CCGGGCTCAGAGGCTATGTGAATTTCTCGAGAAATTCACATAGCCTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000326
RLBP1 MISSION shRNA Lentiviral Transduction Particles
retinaldehyde binding protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000326.4-463s21c1
Sequence:CCGGAGGACCATGGACCTGTCTTTGCTCGAGCAAAGACAGGTCCATGGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000326.4-1556s21c1
Sequence:CCGGCACCTGCCCTTGAAGCTTTAACTCGAGTTAAAGCTTCAAGGGCAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000326.4-823s21c1
Sequence:CCGGTCTCTAGTCGGGACAAGTATGCTCGAGCATACTTGTCCCGACTAGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000326.4-1349s21c1
Sequence:CCGGAGCTGAACTGTAGTTAGAATCCTCGAGGATTCTAACTACAGTTCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000326.3-878s1c1
Sequence:CCGGGCAAAGTCAAGAAATCACCTTCTCGAGAAGGTGATTTCTTGACTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000326.3-971s1c1
Sequence:CCGGCTTCTGCATCATTGAGAACTTCTCGAGAAGTTCTCAATGATGCAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000326.3-1124s1c1
Sequence:CCGGCACGACCTACAATGTGGTCAACTCGAGTTGACCACATTGTAGGTCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000326.3-1256s1c1
Sequence:CCGGGCTGCCCAAGTATGATGGCAACTCGAGTTGCCATCATACTTGGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000326.3-719s1c1
Sequence:CCGGGCTCAGAGGCTATGTGAATTTCTCGAGAAATTCACATAGCCTCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020599
RLBP1 MISSION shRNA Bacterial Glycerol Stock
retinaldehyde binding protein 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020599.2-1810s21c1
Sequence:CCGGTGTAATCGCTTTGATACTTAGCTCGAGCTAAGTATCAAAGCGATTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020599.2-872s21c1
Sequence:CCGGTTCGATGTGGGTCGTGCTTATCTCGAGATAAGCACGACCCACATCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020599.1-1417s1c1
Sequence:CCGGGCAGTGACTCTGAGAGAAGTTCTCGAGAACTTCTCTCAGAGTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020599.1-307s1c1
Sequence:CCGGCAAGGATCATGGTCCTGTCTTCTCGAGAAGACAGGACCATGATCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020599.1-725s1c1
Sequence:CCGGCACTGTGAAGAAGTGACCTTTCTCGAGAAAGGTCACTTCTTCACAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020599.1-814s1c1
Sequence:CCGGCGGCTTCTGTATTGTTGAGAACTCGAGTTCTCAACAATACAGAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020599.1-970s1c1
Sequence:CCGGCACCACCTATAATGTGGTCAACTCGAGTTGACCACATTATAGGTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020599
RLBP1 MISSION shRNA shRNA Plasmid DNA
retinaldehyde binding protein 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020599.2-1810s21c1
Sequence:CCGGTGTAATCGCTTTGATACTTAGCTCGAGCTAAGTATCAAAGCGATTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020599.2-872s21c1
Sequence:CCGGTTCGATGTGGGTCGTGCTTATCTCGAGATAAGCACGACCCACATCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020599.1-1417s1c1
Sequence:CCGGGCAGTGACTCTGAGAGAAGTTCTCGAGAACTTCTCTCAGAGTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020599.1-307s1c1
Sequence:CCGGCAAGGATCATGGTCCTGTCTTCTCGAGAAGACAGGACCATGATCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020599.1-725s1c1
Sequence:CCGGCACTGTGAAGAAGTGACCTTTCTCGAGAAAGGTCACTTCTTCACAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020599.1-814s1c1
Sequence:CCGGCGGCTTCTGTATTGTTGAGAACTCGAGTTCTCAACAATACAGAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020599.1-970s1c1
Sequence:CCGGCACCACCTATAATGTGGTCAACTCGAGTTGACCACATTATAGGTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020599
RLBP1 MISSION shRNA Lentiviral Transduction Particles
retinaldehyde binding protein 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020599.2-1810s21c1
Sequence:CCGGTGTAATCGCTTTGATACTTAGCTCGAGCTAAGTATCAAAGCGATTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020599.2-872s21c1
Sequence:CCGGTTCGATGTGGGTCGTGCTTATCTCGAGATAAGCACGACCCACATCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020599.1-1417s1c1
Sequence:CCGGGCAGTGACTCTGAGAGAAGTTCTCGAGAACTTCTCTCAGAGTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020599.1-307s1c1
Sequence:CCGGCAAGGATCATGGTCCTGTCTTCTCGAGAAGACAGGACCATGATCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020599.1-725s1c1
Sequence:CCGGCACTGTGAAGAAGTGACCTTTCTCGAGAAAGGTCACTTCTTCACAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020599.1-814s1c1
Sequence:CCGGCGGCTTCTGTATTGTTGAGAACTCGAGTTCTCAACAATACAGAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020599.1-970s1c1
Sequence:CCGGCACCACCTATAATGTGGTCAACTCGAGTTGACCACATTATAGGTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)