EMAIL THIS PAGE TO A FRIEND

RLIM

ring finger protein, LIM domain interacting

167 Gene Product Result for
Synonyms: NY-REN-43 RNF12
UniProtKB ID: Q9NVW2, D3DTE0, Q96D38, Q9Y598
Gene ID:
Human(51132) Summary: The protein encoded by this gene is a RING-H2 zinc finger protein. It has been shown to be an E3 ubiquitin protein ligase that targets LIM domain binding 1 (LDB1/CLIM), and causes proteasome-dependent degradation of LDB1. This protein and LDB1 are co-repressors of LHX1/LIM-1, a homeodomain transcription factor. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Feb 2009]
Mouse(19820) ring finger protein, LIM domain interacting
Rat(317241) ring finger protein, LIM domain interacting
chicken(395630) ring finger protein, LIM domain interacting
Horse(100059136) ring finger protein, LIM domain interacting
domestic cat(101099530) ring finger protein, LIM domain interacting
dog(491965) ring finger protein, LIM domain interacting
naked mole-rat(101723344) ring finger protein, LIM domain interacting
Domestic Rabbit(100352111) ring finger protein, LIM domain interacting
domestic guinea pig(100719423) ring finger protein, LIM domain interacting
cow(539871) ring finger protein, LIM domain interacting
cow(785287) ring finger protein, LIM domain interacting
sheep(101112954) ring finger protein, LIM domain interacting
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016120 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016120 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016120 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011276 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011276 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011276 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016120 Rosetta Predictions human pricing
NM_183353 Rosetta Predictions human pricing
NM_001024892 Rosetta Predictions rat pricing
NM_011276 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238255 predicted 624
2 SASI_Hs02_00348888 predicted 2045
3 SASI_Hs01_00238257 predicted 790
4 SASI_Hs01_00238258 predicted 505
5 SASI_Hs01_00238259 predicted 781
6 SASI_Hs02_00348889 predicted 2083
7 SASI_Hs02_00348890 predicted 1946
8 SASI_Hs02_00348891 predicted 2096
9 SASI_Hs02_00348892 predicted 1039
10 SASI_Hs01_00238261 predicted 1349
11 SASI_Hs01_00238256 predicted 620
12 SASI_Hs01_00238260 predicted 1338
13 SASI_Hs01_00238262 predicted 1875
14 SASI_Hs01_00238263 predicted 1354
15 SASI_Hs01_00238264 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199056 predicted 681
2 SASI_Hs02_00371265 predicted 2101
3 SASI_Hs01_00199058 predicted 853
4 SASI_Hs01_00199059 predicted 571
5 SASI_Hs01_00199060 predicted 841
6 SASI_Hs02_00371266 predicted 2140
7 SASI_Hs02_00371267 predicted 2003
8 SASI_Hs02_00371268 predicted 2157
9 SASI_Hs02_00371269 predicted 1104
10 SASI_Hs01_00199062 predicted 1410
11 SASI_Hs01_00199057 predicted 674
12 SASI_Hs01_00199061 predicted 1405
13 SASI_Hs01_00199063 predicted 1932
14 SASI_Hs01_00199064 predicted 1418
15 SASI_Hs01_00199065 predicted 1394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024892 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059335 predicted 1214
2 SASI_Rn01_00059336 predicted 1034
3 SASI_Rn01_00059337 predicted 1385
4 SASI_Rn02_00202788 predicted 1409
5 SASI_Rn01_00059339 predicted 479
6 SASI_Rn01_00059340 predicted 500
7 SASI_Rn01_00059341 predicted 1768
8 SASI_Rn01_00059342 predicted 1146
9 SASI_Rn01_00059343 predicted 1611
10 SASI_Rn02_00202789 predicted 1338
11 SASI_Rn01_00059334 predicted 1879
12 SASI_Rn01_00059338 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011276 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138349 predicted 1115
2 SASI_Mm01_00138350 predicted 1904
3 SASI_Mm01_00138351 predicted 1527
4 SASI_Mm01_00138352 predicted 1467
5 SASI_Mm01_00138353 predicted 715
6 SASI_Mm01_00138354 predicted 1713
7 SASI_Mm01_00138355 predicted 1528
8 SASI_Mm01_00138356 predicted 1429
9 SASI_Mm01_00138357 predicted 1236
10 SASI_Mm02_00320306 predicted 1329
11 SASI_Mm01_00138358 predicted 1463
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016120
VALIDATED
RLIM MISSION shRNA Bacterial Glycerol Stock
ring finger protein, LIM domain interacting
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016120.3-2517s21c1
Sequence:CCGGGTGATTAAAGCTATATCATTCCTCGAGGAATGATATAGCTTTAATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016120.3-1358s21c1
Sequence:CCGGCCTATGTCAGTACCATCAGAACTCGAGTTCTGATGGTACTGACATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016120.3-1776s21c1
Sequence:CCGGCCCAGTCACATTTGATGAAAGCTCGAGCTTTCATCAAATGTGACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016120.3-1001s21c1
Sequence:CCGGAGACGGAGGGAAGTTCTAGAACTCGAGTTCTAGAACTTCCCTCCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016120.3-2313s21c1
Sequence:CCGGTCTGATTTCCGTACCAGTTAACTCGAGTTAACTGGTACGGAAATCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016120.3-2469s21c1
Sequence:CCGGGCAAAGGAAATTACCAGTTTACTCGAGTAAACTGGTAATTTCCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016120.3-624s21c1
Sequence:CCGGTGGTGATTTCAGATTCAGTTTCTCGAGAAACTGAATCTGAAATCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016120.x-316s1c1
Sequence:CCGGGTAAATAACCTGAGTGAAGAACTCGAGTTCTTCACTCAGGTTATTTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016120.x-1217s1c1
Sequence:CCGGGAGATAGCATAGCCAGCAGAACTCGAGTTCTGCTGGCTATGCTATCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_016120.x-1499s1c1
Sequence:CCGGGCTCAGTCTCAAATCGAAATACTCGAGTATTTCGATTTGAGACTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_016120.x-2112s1c1
Sequence:CCGGGCTGATATAGTGATGGGCAAACTCGAGTTTGCCCATCACTATATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_016120.x-1936s1c1
Sequence:CCGGGAATATACAGAAGGCAACAAACTCGAGTTTGTTGCCTTCTGTATATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016120
VALIDATED
RLIM MISSION shRNA shRNA Plasmid DNA
ring finger protein, LIM domain interacting
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016120.3-2517s21c1
Sequence:CCGGGTGATTAAAGCTATATCATTCCTCGAGGAATGATATAGCTTTAATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016120.3-1358s21c1
Sequence:CCGGCCTATGTCAGTACCATCAGAACTCGAGTTCTGATGGTACTGACATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016120.3-1776s21c1
Sequence:CCGGCCCAGTCACATTTGATGAAAGCTCGAGCTTTCATCAAATGTGACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016120.3-1001s21c1
Sequence:CCGGAGACGGAGGGAAGTTCTAGAACTCGAGTTCTAGAACTTCCCTCCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016120.3-2313s21c1
Sequence:CCGGTCTGATTTCCGTACCAGTTAACTCGAGTTAACTGGTACGGAAATCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016120.3-2469s21c1
Sequence:CCGGGCAAAGGAAATTACCAGTTTACTCGAGTAAACTGGTAATTTCCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016120.3-624s21c1
Sequence:CCGGTGGTGATTTCAGATTCAGTTTCTCGAGAAACTGAATCTGAAATCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016120.x-316s1c1
Sequence:CCGGGTAAATAACCTGAGTGAAGAACTCGAGTTCTTCACTCAGGTTATTTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016120.x-1217s1c1
Sequence:CCGGGAGATAGCATAGCCAGCAGAACTCGAGTTCTGCTGGCTATGCTATCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_016120.x-1499s1c1
Sequence:CCGGGCTCAGTCTCAAATCGAAATACTCGAGTATTTCGATTTGAGACTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_016120.x-2112s1c1
Sequence:CCGGGCTGATATAGTGATGGGCAAACTCGAGTTTGCCCATCACTATATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_016120.x-1936s1c1
Sequence:CCGGGAATATACAGAAGGCAACAAACTCGAGTTTGTTGCCTTCTGTATATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016120
VALIDATED
RLIM MISSION shRNA Lentiviral Transduction Particles
ring finger protein, LIM domain interacting
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016120.3-2517s21c1
Sequence:CCGGGTGATTAAAGCTATATCATTCCTCGAGGAATGATATAGCTTTAATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016120.3-1358s21c1
Sequence:CCGGCCTATGTCAGTACCATCAGAACTCGAGTTCTGATGGTACTGACATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016120.3-1776s21c1
Sequence:CCGGCCCAGTCACATTTGATGAAAGCTCGAGCTTTCATCAAATGTGACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016120.3-1001s21c1
Sequence:CCGGAGACGGAGGGAAGTTCTAGAACTCGAGTTCTAGAACTTCCCTCCGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016120.3-2313s21c1
Sequence:CCGGTCTGATTTCCGTACCAGTTAACTCGAGTTAACTGGTACGGAAATCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016120.3-2469s21c1
Sequence:CCGGGCAAAGGAAATTACCAGTTTACTCGAGTAAACTGGTAATTTCCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016120.3-624s21c1
Sequence:CCGGTGGTGATTTCAGATTCAGTTTCTCGAGAAACTGAATCTGAAATCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016120.x-316s1c1
Sequence:CCGGGTAAATAACCTGAGTGAAGAACTCGAGTTCTTCACTCAGGTTATTTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016120.x-1217s1c1
Sequence:CCGGGAGATAGCATAGCCAGCAGAACTCGAGTTCTGCTGGCTATGCTATCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_016120.x-1499s1c1
Sequence:CCGGGCTCAGTCTCAAATCGAAATACTCGAGTATTTCGATTTGAGACTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_016120.x-2112s1c1
Sequence:CCGGGCTGATATAGTGATGGGCAAACTCGAGTTTGCCCATCACTATATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_016120.x-1936s1c1
Sequence:CCGGGAATATACAGAAGGCAACAAACTCGAGTTTGTTGCCTTCTGTATATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011276
VALIDATED
RLIM MISSION shRNA Bacterial Glycerol Stock
ring finger protein, LIM domain interacting
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011276.3-1703s21c1
Sequence:CCGGCGAGAGTAGCTCAGAGATGTTCTCGAGAACATCTCTGAGCTACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011276.3-1424s21c1
Sequence:CCGGGAGTACTATCAGGATTCCTATCTCGAGATAGGAATCCTGATAGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011276.3-1447s21c1
Sequence:CCGGGCAGAATCTTAAATACTGGATCTCGAGATCCAGTATTTAAGATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011276.3-3141s21c1
Sequence:CCGGGCCCTGAAGAATGGACCATATCTCGAGATATGGTCCATTCTTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011276.3-1233s21c1
Sequence:CCGGCCTCCAACCATAGTTCTTGATCTCGAGATCAAGAACTATGGTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011276.3-3141s1c1
Sequence:CCGGGCCCTGAAGAATGGACCATATCTCGAGATATGGTCCATTCTTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011276.3-1447s1c1
Sequence:CCGGGCAGAATCTTAAATACTGGATCTCGAGATCCAGTATTTAAGATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011276.3-1703s1c1
Sequence:CCGGCGAGAGTAGCTCAGAGATGTTCTCGAGAACATCTCTGAGCTACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011276.3-1424s1c1
Sequence:CCGGGAGTACTATCAGGATTCCTATCTCGAGATAGGAATCCTGATAGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011276.3-1233s1c1
Sequence:CCGGCCTCCAACCATAGTTCTTGATCTCGAGATCAAGAACTATGGTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011276
VALIDATED
RLIM MISSION shRNA shRNA Plasmid DNA
ring finger protein, LIM domain interacting
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011276.3-1703s21c1
Sequence:CCGGCGAGAGTAGCTCAGAGATGTTCTCGAGAACATCTCTGAGCTACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011276.3-1424s21c1
Sequence:CCGGGAGTACTATCAGGATTCCTATCTCGAGATAGGAATCCTGATAGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011276.3-1447s21c1
Sequence:CCGGGCAGAATCTTAAATACTGGATCTCGAGATCCAGTATTTAAGATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011276.3-3141s21c1
Sequence:CCGGGCCCTGAAGAATGGACCATATCTCGAGATATGGTCCATTCTTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011276.3-1233s21c1
Sequence:CCGGCCTCCAACCATAGTTCTTGATCTCGAGATCAAGAACTATGGTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011276.3-3141s1c1
Sequence:CCGGGCCCTGAAGAATGGACCATATCTCGAGATATGGTCCATTCTTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011276.3-1447s1c1
Sequence:CCGGGCAGAATCTTAAATACTGGATCTCGAGATCCAGTATTTAAGATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011276.3-1703s1c1
Sequence:CCGGCGAGAGTAGCTCAGAGATGTTCTCGAGAACATCTCTGAGCTACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011276.3-1424s1c1
Sequence:CCGGGAGTACTATCAGGATTCCTATCTCGAGATAGGAATCCTGATAGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011276.3-1233s1c1
Sequence:CCGGCCTCCAACCATAGTTCTTGATCTCGAGATCAAGAACTATGGTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011276
VALIDATED
RLIM MISSION shRNA Lentiviral Transduction Particles
ring finger protein, LIM domain interacting
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011276.3-1703s21c1
Sequence:CCGGCGAGAGTAGCTCAGAGATGTTCTCGAGAACATCTCTGAGCTACTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011276.3-1424s21c1
Sequence:CCGGGAGTACTATCAGGATTCCTATCTCGAGATAGGAATCCTGATAGTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011276.3-1447s21c1
Sequence:CCGGGCAGAATCTTAAATACTGGATCTCGAGATCCAGTATTTAAGATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011276.3-3141s21c1
Sequence:CCGGGCCCTGAAGAATGGACCATATCTCGAGATATGGTCCATTCTTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011276.3-1233s21c1
Sequence:CCGGCCTCCAACCATAGTTCTTGATCTCGAGATCAAGAACTATGGTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011276.3-3141s1c1
Sequence:CCGGGCCCTGAAGAATGGACCATATCTCGAGATATGGTCCATTCTTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011276.3-1447s1c1
Sequence:CCGGGCAGAATCTTAAATACTGGATCTCGAGATCCAGTATTTAAGATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011276.3-1703s1c1
Sequence:CCGGCGAGAGTAGCTCAGAGATGTTCTCGAGAACATCTCTGAGCTACTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011276.3-1424s1c1
Sequence:CCGGGAGTACTATCAGGATTCCTATCTCGAGATAGGAATCCTGATAGTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011276.3-1233s1c1
Sequence:CCGGCCTCCAACCATAGTTCTTGATCTCGAGATCAAGAACTATGGTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)