EMAIL THIS PAGE TO A FRIEND

RLN1

relaxin 1

66 Gene Product Result for
Synonyms: H1 H1RLX RLXH1 bA12D24.3.1 bA12D24.3.2
UniProtKB ID: P04808, Q99936, Q9UQJ1
Gene ID:
Human(6013) Summary: Relaxins are known endocrine and autocrine/paracrine hormones, belonging to the insulin gene superfamily. In humans there are three non-allelic relaxin genes, RLN1, RLN2 and RLN3, where RLN1 and RLN2 share high sequence homology. The protein encoded by this gene is synthesized as a single-chain polypeptide but the active form consists of an A chain and a B chain linked by disulfide bonds. Relaxin is produced by the ovary, and targets the mammalian reproductive system to ripen the cervix, elongate the pubic symphysis and inhibit uterine contraction. It may have additional roles in enhancing sperm motility, regulating blood pressure, controlling heart rate and releasing oxytocin and vasopressin. [provided by RefSeq, Jan 2013]
Mouse(19773) relaxin 1
Rat(25616) relaxin 1
dog(403742) relaxin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006911 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011272 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011272 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011272 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006911 Rosetta Predictions human pricing
NM_013413 Rosetta Predictions rat pricing
NM_011272 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060044 predicted 386
2 SASI_Hs01_00060045 predicted 640
3 SASI_Hs01_00060046 predicted 485
4 SASI_Hs01_00060047 predicted 461
5 SASI_Hs01_00060048 predicted 640
6 SASI_Hs01_00060049 predicted 333
7 SASI_Hs01_00060050 predicted 359
8 SASI_Hs01_00060051 predicted 333
9 SASI_Hs01_00060052 predicted 462
10 SASI_Hs01_00060053 predicted 196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013413 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062916 predicted 497
2 SASI_Rn01_00062917 predicted 287
3 SASI_Rn01_00062918 predicted 576
4 SASI_Rn02_00261118 predicted 562
5 SASI_Rn01_00062919 predicted 404
6 SASI_Rn01_00062920 predicted 303
7 SASI_Rn01_00062921 predicted 252
8 SASI_Rn01_00062922 predicted 477
9 SASI_Rn01_00062923 predicted 558
10 SASI_Rn01_00062924 predicted 290
11 SASI_Rn01_00062925 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119673 predicted 434
2 SASI_Mm01_00119674 predicted 207
3 SASI_Mm01_00119675 predicted 337
4 SASI_Mm01_00119676 predicted 246
5 SASI_Mm01_00119677 predicted 433
6 SASI_Mm01_00119678 predicted 362
7 SASI_Mm01_00119679 predicted 416
8 SASI_Mm01_00119680 predicted 237
9 SASI_Mm01_00119681 predicted 454
10 SASI_Mm01_00119682 predicted 342
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006911
RLN1 MISSION shRNA Bacterial Glycerol Stock
relaxin 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006911.2-443s1c1
Sequence:CCGGCAACCATCATTACCAGAGCTACTCGAGTAGCTCTGGTAATGATGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006911.2-476s1c1
Sequence:CCGGCCTGCATTAAAGGATTCCAATCTCGAGATTGGAATCCTTTAATGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006911.2-347s1c1
Sequence:CCGGCCATCCTTCATCAACAAAGATCTCGAGATCTTTGTTGATGAAGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006911.2-582s1c1
Sequence:CCGGGCTTGGATACTCATTCTCAAACTCGAGTTTGAGAATGAGTATCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006911.2-344s1c1
Sequence:CCGGGTACCATCCTTCATCAACAAACTCGAGTTTGTTGATGAAGGATGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006911.2-202s1c1
Sequence:CCGGCAAATGGAAGGACGATGTTATCTCGAGATAACATCGTCCTTCCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151299    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006911.2-686s1c1
Sequence:CCGGGATGAAGCTAATTGTGCACATCTCGAGATGTGCACAATTAGCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006911.2-733s1c1
Sequence:CCGGGATGACATTTCACTGATGCTTCTCGAGAAGCATCAGTGAAATGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152072    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006911.2-720s1c1
Sequence:CCGGCACACATAGTCTTGATGACATCTCGAGATGTCATCAAGACTATGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006911.2-689s1c1
Sequence:CCGGGAAGCTAATTGTGCACATCTTCTCGAGAAGATGTGCACAATTAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006911.2-330s1c1
Sequence:CCGGCAGTGGCAGAAATTGTACCATCTCGAGATGGTACAATTTCTGCCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006911
RLN1 MISSION shRNA shRNA Plasmid DNA
relaxin 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006911.2-443s1c1
Sequence:CCGGCAACCATCATTACCAGAGCTACTCGAGTAGCTCTGGTAATGATGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006911.2-476s1c1
Sequence:CCGGCCTGCATTAAAGGATTCCAATCTCGAGATTGGAATCCTTTAATGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006911.2-347s1c1
Sequence:CCGGCCATCCTTCATCAACAAAGATCTCGAGATCTTTGTTGATGAAGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006911.2-582s1c1
Sequence:CCGGGCTTGGATACTCATTCTCAAACTCGAGTTTGAGAATGAGTATCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006911.2-344s1c1
Sequence:CCGGGTACCATCCTTCATCAACAAACTCGAGTTTGTTGATGAAGGATGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006911.2-202s1c1
Sequence:CCGGCAAATGGAAGGACGATGTTATCTCGAGATAACATCGTCCTTCCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151299    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006911.2-686s1c1
Sequence:CCGGGATGAAGCTAATTGTGCACATCTCGAGATGTGCACAATTAGCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006911.2-733s1c1
Sequence:CCGGGATGACATTTCACTGATGCTTCTCGAGAAGCATCAGTGAAATGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152072    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006911.2-720s1c1
Sequence:CCGGCACACATAGTCTTGATGACATCTCGAGATGTCATCAAGACTATGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006911.2-689s1c1
Sequence:CCGGGAAGCTAATTGTGCACATCTTCTCGAGAAGATGTGCACAATTAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006911.2-330s1c1
Sequence:CCGGCAGTGGCAGAAATTGTACCATCTCGAGATGGTACAATTTCTGCCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006911
RLN1 MISSION shRNA Lentiviral Transduction Particles
relaxin 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006911.2-443s1c1
Sequence:CCGGCAACCATCATTACCAGAGCTACTCGAGTAGCTCTGGTAATGATGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006911.2-476s1c1
Sequence:CCGGCCTGCATTAAAGGATTCCAATCTCGAGATTGGAATCCTTTAATGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006911.2-347s1c1
Sequence:CCGGCCATCCTTCATCAACAAAGATCTCGAGATCTTTGTTGATGAAGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006911.2-582s1c1
Sequence:CCGGGCTTGGATACTCATTCTCAAACTCGAGTTTGAGAATGAGTATCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006911.2-344s1c1
Sequence:CCGGGTACCATCCTTCATCAACAAACTCGAGTTTGTTGATGAAGGATGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006911.2-202s1c1
Sequence:CCGGCAAATGGAAGGACGATGTTATCTCGAGATAACATCGTCCTTCCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151299    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006911.2-686s1c1
Sequence:CCGGGATGAAGCTAATTGTGCACATCTCGAGATGTGCACAATTAGCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006911.2-733s1c1
Sequence:CCGGGATGACATTTCACTGATGCTTCTCGAGAAGCATCAGTGAAATGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152072    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006911.2-720s1c1
Sequence:CCGGCACACATAGTCTTGATGACATCTCGAGATGTCATCAAGACTATGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152386    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006911.2-689s1c1
Sequence:CCGGGAAGCTAATTGTGCACATCTTCTCGAGAAGATGTGCACAATTAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006911.2-330s1c1
Sequence:CCGGCAGTGGCAGAAATTGTACCATCTCGAGATGGTACAATTTCTGCCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011272
RLN1 MISSION shRNA Bacterial Glycerol Stock
relaxin 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000120352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011272.1-247s1c1
Sequence:CCGGCCTTTCGATACGACGCTGAAACTCGAGTTTCAGCGTCGTATCGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011272.1-220s1c1
Sequence:CCGGCCATCCTTCATCAACAAAGATCTCGAGATCTTTGTTGATGAAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011272.1-346s1c1
Sequence:CCGGCCTGTGTTGAGCGATTCTGTTCTCGAGAACAGAATCGCTCAACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011272.1-433s1c1
Sequence:CCGGCCAGGGCTTAAATACTTGCAACTCGAGTTGCAAGTATTTAAGCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011272
RLN1 MISSION shRNA shRNA Plasmid DNA
relaxin 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000120352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011272.1-247s1c1
Sequence:CCGGCCTTTCGATACGACGCTGAAACTCGAGTTTCAGCGTCGTATCGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011272.1-220s1c1
Sequence:CCGGCCATCCTTCATCAACAAAGATCTCGAGATCTTTGTTGATGAAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011272.1-346s1c1
Sequence:CCGGCCTGTGTTGAGCGATTCTGTTCTCGAGAACAGAATCGCTCAACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011272.1-433s1c1
Sequence:CCGGCCAGGGCTTAAATACTTGCAACTCGAGTTGCAAGTATTTAAGCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011272
RLN1 MISSION shRNA Lentiviral Transduction Particles
relaxin 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000120352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011272.1-247s1c1
Sequence:CCGGCCTTTCGATACGACGCTGAAACTCGAGTTTCAGCGTCGTATCGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011272.1-220s1c1
Sequence:CCGGCCATCCTTCATCAACAAAGATCTCGAGATCTTTGTTGATGAAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011272.1-346s1c1
Sequence:CCGGCCTGTGTTGAGCGATTCTGTTCTCGAGAACAGAATCGCTCAACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011272.1-433s1c1
Sequence:CCGGCCAGGGCTTAAATACTTGCAACTCGAGTTGCAAGTATTTAAGCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)