EMAIL THIS PAGE TO A FRIEND

RLN3

relaxin 3

49 Gene Product Result for
Synonyms: H3 RXN3 ZINS4 insl7
UniProtKB ID: Q8WXF3, Q6UXW5
Gene ID:
Human(117579) Summary: Relaxins are known endocrine and autocrine/paracrine hormones, belonging to the insulin gene superfamily. In the human there are three non-allelic relaxin genes, RLN1, RLN2 and RLN3. RLN1 and RLN2 share high sequence homology. Relaxin is produced by the ovary, and targets the mammalian reproductive system to ripen the cervix, elongate the pubic symphysis and inhibit uterine contraction. It may have additional roles in enhancing sperm motility, regulating blood pressure, controlling heart rate and releasing oxytocin and vasopressin. The protein encoded by this gene is a member of the relaxin family. The active form of the encoded protein consists of an A chain and a B chain but their cleavage sites are not definitely described yet. It may play a role in neuropeptide signaling processes. [provided by RefSeq, Jul 2008]
Mouse(212108) relaxin 3
Rat(266997) relaxin 3
chicken(427223) relaxin 3
dog(610834) relaxin 3
cow(100300034) relaxin 3
sheep(101119133) relaxin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA043731 Anti-RLN3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080864 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080864 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080864 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173184 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173184 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173184 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080864 Rosetta Predictions human pricing
NM_170667 Rosetta Predictions rat pricing
NM_173184 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167606 predicted 225
2 SASI_Hs02_00362639 predicted 91
3 SASI_Hs02_00362640 predicted 166
4 SASI_Hs02_00362641 predicted 89
5 SASI_Hs02_00362642 predicted 96
6 SASI_Hs02_00362643 predicted 88
7 SASI_Hs02_00362644 predicted 413
8 SASI_Hs02_00362645 predicted 110
9 SASI_Hs02_00362646 predicted 100
10 SASI_Hs02_00362647 predicted 170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269045 predicted 214
2 SASI_Rn02_00269046 predicted 206
3 SASI_Rn02_00269047 predicted 215
4 SASI_Rn02_00269048 predicted 236
5 SASI_Rn01_00031011 predicted 326
6 SASI_Rn02_00269049 predicted 112
7 SASI_Rn02_00269050 predicted 177
8 SASI_Rn01_00031012 predicted 325
9 SASI_Rn02_00269051 predicted 128
10 SASI_Rn02_00269052 predicted 80
11 SASI_Rn01_00031008 predicted 578
12 SASI_Rn01_00031009 predicted 566
13 SASI_Rn01_00031010 predicted 699
14 SASI_Rn01_00031013 predicted 429
15 SASI_Rn01_00031014 predicted 702
16 SASI_Rn01_00031015 predicted 369
17 SASI_Rn01_00031016 predicted 563
18 SASI_Rn01_00031017 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098414 predicted 247
2 SASI_Mm01_00098416 predicted 209
3 SASI_Mm01_00098417 predicted 244
4 SASI_Mm01_00098418 predicted 211
5 SASI_Mm01_00098419 predicted 219
6 SASI_Mm01_00098420 predicted 218
7 SASI_Mm01_00098415 predicted 247
8 SASI_Mm01_00098421 predicted 442
9 SASI_Mm01_00098422 predicted 280
10 SASI_Mm01_00098423 predicted 323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080864
RLN3 MISSION shRNA Bacterial Glycerol Stock
relaxin 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080864.2-211s21c1
Sequence:CCGGGATGCTGATGAAGACAGTCTGCTCGAGCAGACTGTCTTCATCAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080864.2-181s21c1
Sequence:CCGGGAGGCTATGGGAGATACCTTCCTCGAGGAAGGTATCTCCCATAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080864.2-116s21c1
Sequence:CCGGTCATCCGAGCAGTCATCTTCACTCGAGTGAAGATGACTGCTCGGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080864.2-150s21c1
Sequence:CCGGCCGGTGGAGACGATCAGACATCTCGAGATGTCTGATCGTCTCCACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080864.2-193s21c1
Sequence:CCGGGATACCTTCCCGGATGCAGATCTCGAGATCTGCATCCGGGAAGGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080864
RLN3 MISSION shRNA shRNA Plasmid DNA
relaxin 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080864.2-211s21c1
Sequence:CCGGGATGCTGATGAAGACAGTCTGCTCGAGCAGACTGTCTTCATCAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080864.2-181s21c1
Sequence:CCGGGAGGCTATGGGAGATACCTTCCTCGAGGAAGGTATCTCCCATAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080864.2-116s21c1
Sequence:CCGGTCATCCGAGCAGTCATCTTCACTCGAGTGAAGATGACTGCTCGGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080864.2-150s21c1
Sequence:CCGGCCGGTGGAGACGATCAGACATCTCGAGATGTCTGATCGTCTCCACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080864.2-193s21c1
Sequence:CCGGGATACCTTCCCGGATGCAGATCTCGAGATCTGCATCCGGGAAGGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080864
RLN3 MISSION shRNA Lentiviral Transduction Particles
relaxin 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080864.2-211s21c1
Sequence:CCGGGATGCTGATGAAGACAGTCTGCTCGAGCAGACTGTCTTCATCAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080864.2-181s21c1
Sequence:CCGGGAGGCTATGGGAGATACCTTCCTCGAGGAAGGTATCTCCCATAGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080864.2-116s21c1
Sequence:CCGGTCATCCGAGCAGTCATCTTCACTCGAGTGAAGATGACTGCTCGGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080864.2-150s21c1
Sequence:CCGGCCGGTGGAGACGATCAGACATCTCGAGATGTCTGATCGTCTCCACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080864.2-193s21c1
Sequence:CCGGGATACCTTCCCGGATGCAGATCTCGAGATCTGCATCCGGGAAGGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173184
RLN3 MISSION shRNA Bacterial Glycerol Stock
relaxin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173184.1-186s1c1
Sequence:CCGGGACATCTTGGCCCACGAATCTCTCGAGAGATTCGTGGGCCAAGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173184.1-221s1c1
Sequence:CCGGCGCTGATGGAGAAGCCAATACCTCGAGGTATTGGCTTCTCCATCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173184.1-286s1c1
Sequence:CCGGAGTGGCTGGCCCTAACCAAATCTCGAGATTTGGTTAGGGCCAGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173184.1-212s1c1
Sequence:CCGGGGACTTCTTCGCTGATGGAGACTCGAGTCTCCATCAGCGAAGAAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173184.1-150s1c1
Sequence:CCGGATCTTCACTTGCGGAGGCTCACTCGAGTGAGCCTCCGCAAGTGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173184
RLN3 MISSION shRNA shRNA Plasmid DNA
relaxin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173184.1-186s1c1
Sequence:CCGGGACATCTTGGCCCACGAATCTCTCGAGAGATTCGTGGGCCAAGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173184.1-221s1c1
Sequence:CCGGCGCTGATGGAGAAGCCAATACCTCGAGGTATTGGCTTCTCCATCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173184.1-286s1c1
Sequence:CCGGAGTGGCTGGCCCTAACCAAATCTCGAGATTTGGTTAGGGCCAGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173184.1-212s1c1
Sequence:CCGGGGACTTCTTCGCTGATGGAGACTCGAGTCTCCATCAGCGAAGAAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173184.1-150s1c1
Sequence:CCGGATCTTCACTTGCGGAGGCTCACTCGAGTGAGCCTCCGCAAGTGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173184
RLN3 MISSION shRNA Lentiviral Transduction Particles
relaxin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173184.1-186s1c1
Sequence:CCGGGACATCTTGGCCCACGAATCTCTCGAGAGATTCGTGGGCCAAGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173184.1-221s1c1
Sequence:CCGGCGCTGATGGAGAAGCCAATACCTCGAGGTATTGGCTTCTCCATCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173184.1-286s1c1
Sequence:CCGGAGTGGCTGGCCCTAACCAAATCTCGAGATTTGGTTAGGGCCAGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173184.1-212s1c1
Sequence:CCGGGGACTTCTTCGCTGATGGAGACTCGAGTCTCCATCAGCGAAGAAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173184.1-150s1c1
Sequence:CCGGATCTTCACTTGCGGAGGCTCACTCGAGTGAGCCTCCGCAAGTGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)