EMAIL THIS PAGE TO A FRIEND

RLTPR

RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing

40 Gene Product Result for
Synonyms: CARMIL2 CARMIL2b LRRC16C
UniProtKB ID: Q6F5E8
Gene ID:
Mouse(234695) RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing
Zebrafish(567870) RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing
chicken(415666) RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing
dog(479683) RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing
domestic cat(101089818) RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing
cow(510354) RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing
sheep(101108771) RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing
domestic guinea pig(100732300) RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing
naked mole-rat(101708616) RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033320 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033320 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033320 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001013838 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013838 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013838 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097371 MISSION® esiRNA esiRNA human RLTPR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013838 Rosetta Predictions human pricing
NM_001033320 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157371 predicted 3825
2 SASI_Hs01_00157372 predicted 3621
3 SASI_Hs01_00157373 predicted 829
4 SASI_Hs01_00157374 predicted 1857
5 SASI_Hs01_00157375 predicted 599
6 SASI_Hs01_00157376 predicted 1208
7 SASI_Hs01_00157377 predicted 891
8 SASI_Hs01_00157378 predicted 3738
9 SASI_Hs01_00157379 predicted 817
10 SASI_Hs01_00157380 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288540 predicted 368
2 SASI_Mm02_00288541 predicted 846
3 SASI_Mm02_00288542 predicted 1890
4 SASI_Mm02_00288543 predicted 1537
5 SASI_Mm02_00288544 predicted 550
6 SASI_Mm02_00288545 predicted 1553
7 SASI_Mm02_00288546 predicted 1083
8 SASI_Mm02_00288547 predicted 1762
9 SASI_Mm02_00288548 predicted 271
10 SASI_Mm01_00053831 predicted 1961
11 SASI_Mm01_00053830 predicted 461
12 SASI_Mm01_00053832 predicted 417
13 SASI_Mm01_00053833 predicted 1942
14 SASI_Mm01_00053834 predicted 443
15 SASI_Mm01_00053835 predicted 1093
16 SASI_Mm01_00053836 predicted 1453
17 SASI_Mm01_00053837 predicted 692
18 SASI_Mm01_00053838 predicted 1794
19 SASI_Mm01_00053839 predicted 546
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033320
RLTPR MISSION shRNA Bacterial Glycerol Stock
RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033320.2-1946s21c1
Sequence:CCGGAGCAAGAGGAAGCAAAGTAAACTCGAGTTTACTTTGCTTCCTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033320.2-1986s21c1
Sequence:CCGGCAGGCTCTGATGGTGACATTACTCGAGTAATGTCACCATCAGAGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033320.2-2127s21c1
Sequence:CCGGCATTGGGACAGCAGCTGAATGCTCGAGCATTCAGCTGCTGTCCCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033320.2-402s21c1
Sequence:CCGGTTCAGCCCTTAGGTCTGATTTCTCGAGAAATCAGACCTAAGGGCTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033320.2-1542s21c1
Sequence:CCGGAGAAGCTGGGTACGCTCTTTGCTCGAGCAAAGAGCGTACCCAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033320
RLTPR MISSION shRNA shRNA Plasmid DNA
RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033320.2-1946s21c1
Sequence:CCGGAGCAAGAGGAAGCAAAGTAAACTCGAGTTTACTTTGCTTCCTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033320.2-1986s21c1
Sequence:CCGGCAGGCTCTGATGGTGACATTACTCGAGTAATGTCACCATCAGAGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033320.2-2127s21c1
Sequence:CCGGCATTGGGACAGCAGCTGAATGCTCGAGCATTCAGCTGCTGTCCCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033320.2-402s21c1
Sequence:CCGGTTCAGCCCTTAGGTCTGATTTCTCGAGAAATCAGACCTAAGGGCTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033320.2-1542s21c1
Sequence:CCGGAGAAGCTGGGTACGCTCTTTGCTCGAGCAAAGAGCGTACCCAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033320
RLTPR MISSION shRNA Lentiviral Transduction Particles
RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033320.2-1946s21c1
Sequence:CCGGAGCAAGAGGAAGCAAAGTAAACTCGAGTTTACTTTGCTTCCTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033320.2-1986s21c1
Sequence:CCGGCAGGCTCTGATGGTGACATTACTCGAGTAATGTCACCATCAGAGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033320.2-2127s21c1
Sequence:CCGGCATTGGGACAGCAGCTGAATGCTCGAGCATTCAGCTGCTGTCCCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033320.2-402s21c1
Sequence:CCGGTTCAGCCCTTAGGTCTGATTTCTCGAGAAATCAGACCTAAGGGCTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033320.2-1542s21c1
Sequence:CCGGAGAAGCTGGGTACGCTCTTTGCTCGAGCAAAGAGCGTACCCAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013838
RLTPR MISSION shRNA Bacterial Glycerol Stock
RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013838.1-3722s1c1
Sequence:CCGGGAGAAACAGAACTGGCTCCATCTCGAGATGGAGCCAGTTCTGTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013838.1-2441s1c1
Sequence:CCGGCCATTCTATATGAAGCTGGAACTCGAGTTCCAGCTTCATATAGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013838.1-3822s1c1
Sequence:CCGGGCAAAGCAAAGATGGCGAGATCTCGAGATCTCGCCATCTTTGCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013838.1-2920s1c1
Sequence:CCGGGAAGAGGAGAAGGAGAAGGATCTCGAGATCCTTCTCCTTCTCCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013838.1-810s1c1
Sequence:CCGGCCTTGAGGTCTCAGAACAGATCTCGAGATCTGTTCTGAGACCTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013838.1-2416s1c1
Sequence:CCGGGCCAACTTCTCTCTCAGCATTCTCGAGAATGCTGAGAGAGAAGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013838
RLTPR MISSION shRNA shRNA Plasmid DNA
RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013838.1-3722s1c1
Sequence:CCGGGAGAAACAGAACTGGCTCCATCTCGAGATGGAGCCAGTTCTGTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013838.1-2441s1c1
Sequence:CCGGCCATTCTATATGAAGCTGGAACTCGAGTTCCAGCTTCATATAGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013838.1-3822s1c1
Sequence:CCGGGCAAAGCAAAGATGGCGAGATCTCGAGATCTCGCCATCTTTGCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013838.1-2920s1c1
Sequence:CCGGGAAGAGGAGAAGGAGAAGGATCTCGAGATCCTTCTCCTTCTCCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013838.1-810s1c1
Sequence:CCGGCCTTGAGGTCTCAGAACAGATCTCGAGATCTGTTCTGAGACCTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013838.1-2416s1c1
Sequence:CCGGGCCAACTTCTCTCTCAGCATTCTCGAGAATGCTGAGAGAGAAGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013838
RLTPR MISSION shRNA Lentiviral Transduction Particles
RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013838.1-3722s1c1
Sequence:CCGGGAGAAACAGAACTGGCTCCATCTCGAGATGGAGCCAGTTCTGTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013838.1-2441s1c1
Sequence:CCGGCCATTCTATATGAAGCTGGAACTCGAGTTCCAGCTTCATATAGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013838.1-3822s1c1
Sequence:CCGGGCAAAGCAAAGATGGCGAGATCTCGAGATCTCGCCATCTTTGCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013838.1-2920s1c1
Sequence:CCGGGAAGAGGAGAAGGAGAAGGATCTCGAGATCCTTCTCCTTCTCCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013838.1-810s1c1
Sequence:CCGGCCTTGAGGTCTCAGAACAGATCTCGAGATCTGTTCTGAGACCTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013838.1-2416s1c1
Sequence:CCGGGCCAACTTCTCTCTCAGCATTCTCGAGAATGCTGAGAGAGAAGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)