EMAIL THIS PAGE TO A FRIEND

RMDN2

regulator of microtubule dynamics 2

53 Gene Product Result for
Synonyms: FAM82A FAM82A1 PRO34163 PYST9371 RMD-2 RMD2 RMD4
Gene ID:
Mouse(381110) regulator of microtubule dynamics 2
Rat(313840) regulator of microtubule dynamics 2
domestic guinea pig(100713207) regulator of microtubule dynamics 2
naked mole-rat(101699275) regulator of microtubule dynamics 2
cow(506362) family with sequence similarity 82, member A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0107 AQUA Peptide FLDF[K] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144713 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144713 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144713 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201361 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201361 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201361 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144713 Rosetta Predictions human pricing
NM_001037200 Rosetta Predictions rat pricing
NM_201361 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115258 predicted 1076
2 SASI_Hs02_00364655 predicted 1462
3 SASI_Hs01_00115260 predicted 221
4 SASI_Hs01_00115261 predicted 1101
5 SASI_Hs01_00115262 predicted 1209
6 SASI_Hs01_00115263 predicted 1507
7 SASI_Hs01_00115264 predicted 1691
8 SASI_Hs01_00115265 predicted 890
9 SASI_Hs01_00115266 predicted 1410
10 SASI_Hs01_00115267 predicted 1356
11 SASI_Hs01_00115259 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080339 predicted 563
2 SASI_Rn01_00080340 predicted 1001
3 SASI_Rn01_00080341 predicted 1521
4 SASI_Rn01_00080343 predicted 1093
5 SASI_Rn01_00080344 predicted 1637
6 SASI_Rn01_00080345 predicted 1055
7 SASI_Rn01_00080346 predicted 1440
8 SASI_Rn01_00080347 predicted 1134
9 SASI_Rn01_00080348 predicted 1196
10 SASI_Rn02_00204309 predicted 884
11 SASI_Rn01_00080342 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201361 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037263 predicted 921
2 SASI_Mm01_00037264 predicted 254
3 SASI_Mm01_00037265 predicted 1376
4 SASI_Mm01_00037266 predicted 656
5 SASI_Mm01_00037267 predicted 995
6 SASI_Mm01_00037268 predicted 495
7 SASI_Mm01_00037269 predicted 1007
8 SASI_Mm01_00037270 predicted 899
9 SASI_Mm01_00037271 predicted 1354
10 SASI_Mm01_00037272 predicted 1126
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144713
VALIDATED
RMDN2 MISSION shRNA Bacterial Glycerol Stock
regulator of microtubule dynamics 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144713.2-1302s21c1
Sequence:CCGGTGGCGATTTGCTCGTGCTTATCTCGAGATAAGCACGAGCAAATCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-1506s1c1
Sequence:CCGGGCACCTCTTCAAGGAACATCTCTCGAGAGATGTTCCTTGAAGAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-1114s1c1
Sequence:CCGGGCTAATACTGACACAGAAGAACTCGAGTTCTTCTGTGTCAGTATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-1583s1c1
Sequence:CCGGGATACTGCTATACTGTCTCAACTCGAGTTGAGACAGTATAGCAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-1801s1c1
Sequence:CCGGGCTTTATTGCTTCCTACTGTTCTCGAGAACAGTAGGAAGCAATAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144713.2-1196s21c1
Sequence:CCGGTCTTCAGAAGGTAGATCATTTCTCGAGAAATGATCTACCTTCTGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144713.2-231s21c1
Sequence:CCGGAGTATATCTCTTGGTCATAAACTCGAGTTTATGACCAAGAGATATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144713.2-489s21c1
Sequence:CCGGAGACGTTTCTCATCCCGTAAACTCGAGTTTACGGGATGAGAAACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-159s1c1
Sequence:CCGGCCAACGATGTTCTCCAGAAGACTCGAGTCTTCTGGAGAACATCGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-393s1c1
Sequence:CCGGGCAACAAAGTAGAGCTAACTTCTCGAGAAGTTAGCTCTACTTTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144713.1-1711s1c1
Sequence:CCGGCCTGGTTATTCTAATCCCAATCTCGAGATTGGGATTAGAATAACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-524s1c1
Sequence:CCGGCCTATTACAAGAGTGCCATTTCTCGAGAAATGGCACTCTTGTAATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144713.2-459s21c1
Sequence:CCGGGACCATTGTGGTAGCTTTATTCTCGAGAATAAAGCTACCACAATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144713.2-997s21c1
Sequence:CCGGTCCCACCTCAAAGCGAATTAACTCGAGTTAATTCGCTTTGAGGTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144713.2-428s21c1
Sequence:CCGGCACAGGCTTCACTGATATAAACTCGAGTTTATATCAGTGAAGCCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144713
VALIDATED
RMDN2 MISSION shRNA shRNA Plasmid DNA
regulator of microtubule dynamics 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144713.2-1302s21c1
Sequence:CCGGTGGCGATTTGCTCGTGCTTATCTCGAGATAAGCACGAGCAAATCGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-1506s1c1
Sequence:CCGGGCACCTCTTCAAGGAACATCTCTCGAGAGATGTTCCTTGAAGAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-1114s1c1
Sequence:CCGGGCTAATACTGACACAGAAGAACTCGAGTTCTTCTGTGTCAGTATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-1583s1c1
Sequence:CCGGGATACTGCTATACTGTCTCAACTCGAGTTGAGACAGTATAGCAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-1801s1c1
Sequence:CCGGGCTTTATTGCTTCCTACTGTTCTCGAGAACAGTAGGAAGCAATAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144713.2-1196s21c1
Sequence:CCGGTCTTCAGAAGGTAGATCATTTCTCGAGAAATGATCTACCTTCTGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144713.2-231s21c1
Sequence:CCGGAGTATATCTCTTGGTCATAAACTCGAGTTTATGACCAAGAGATATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144713.2-489s21c1
Sequence:CCGGAGACGTTTCTCATCCCGTAAACTCGAGTTTACGGGATGAGAAACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-159s1c1
Sequence:CCGGCCAACGATGTTCTCCAGAAGACTCGAGTCTTCTGGAGAACATCGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-393s1c1
Sequence:CCGGGCAACAAAGTAGAGCTAACTTCTCGAGAAGTTAGCTCTACTTTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144713.1-1711s1c1
Sequence:CCGGCCTGGTTATTCTAATCCCAATCTCGAGATTGGGATTAGAATAACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-524s1c1
Sequence:CCGGCCTATTACAAGAGTGCCATTTCTCGAGAAATGGCACTCTTGTAATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144713.2-459s21c1
Sequence:CCGGGACCATTGTGGTAGCTTTATTCTCGAGAATAAAGCTACCACAATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144713.2-997s21c1
Sequence:CCGGTCCCACCTCAAAGCGAATTAACTCGAGTTAATTCGCTTTGAGGTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144713.2-428s21c1
Sequence:CCGGCACAGGCTTCACTGATATAAACTCGAGTTTATATCAGTGAAGCCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144713
VALIDATED
RMDN2 MISSION shRNA Lentiviral Transduction Particles
regulator of microtubule dynamics 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144713.2-1302s21c1
Sequence:CCGGTGGCGATTTGCTCGTGCTTATCTCGAGATAAGCACGAGCAAATCGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-1506s1c1
Sequence:CCGGGCACCTCTTCAAGGAACATCTCTCGAGAGATGTTCCTTGAAGAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-1114s1c1
Sequence:CCGGGCTAATACTGACACAGAAGAACTCGAGTTCTTCTGTGTCAGTATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-1583s1c1
Sequence:CCGGGATACTGCTATACTGTCTCAACTCGAGTTGAGACAGTATAGCAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-1801s1c1
Sequence:CCGGGCTTTATTGCTTCCTACTGTTCTCGAGAACAGTAGGAAGCAATAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144713.2-1196s21c1
Sequence:CCGGTCTTCAGAAGGTAGATCATTTCTCGAGAAATGATCTACCTTCTGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_144713.2-231s21c1
Sequence:CCGGAGTATATCTCTTGGTCATAAACTCGAGTTTATGACCAAGAGATATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144713.2-489s21c1
Sequence:CCGGAGACGTTTCTCATCCCGTAAACTCGAGTTTACGGGATGAGAAACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-159s1c1
Sequence:CCGGCCAACGATGTTCTCCAGAAGACTCGAGTCTTCTGGAGAACATCGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-393s1c1
Sequence:CCGGGCAACAAAGTAGAGCTAACTTCTCGAGAAGTTAGCTCTACTTTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144713.1-1711s1c1
Sequence:CCGGCCTGGTTATTCTAATCCCAATCTCGAGATTGGGATTAGAATAACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144713.1-524s1c1
Sequence:CCGGCCTATTACAAGAGTGCCATTTCTCGAGAAATGGCACTCTTGTAATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144713.2-459s21c1
Sequence:CCGGGACCATTGTGGTAGCTTTATTCTCGAGAATAAAGCTACCACAATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144713.2-997s21c1
Sequence:CCGGTCCCACCTCAAAGCGAATTAACTCGAGTTAATTCGCTTTGAGGTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144713.2-428s21c1
Sequence:CCGGCACAGGCTTCACTGATATAAACTCGAGTTTATATCAGTGAAGCCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201361
VALIDATED
RMDN2 MISSION shRNA Bacterial Glycerol Stock
regulator of microtubule dynamics 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201361.1-1636s1c1
Sequence:CCGGCCCTAGCAAATTGTTATTGTTCTCGAGAACAATAACAATTTGCTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201361.1-673s1c1
Sequence:CCGGCGGACAAATGAGTCTCACAAACTCGAGTTTGTGAGACTCATTTGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201361.2-813s21c1
Sequence:CCGGAGAAGCATTATGCTAATATTGCTCGAGCAATATTAGCATAATGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201361.2-1605s21c1
Sequence:CCGGGTAACCAATACGTAATCTAATCTCGAGATTAGATTACGTATTGGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201361.2-1093s21c1
Sequence:CCGGGTTCGGAGAAATACCATATTCCTCGAGGAATATGGTATTTCTCCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201361.2-1169s21c1
Sequence:CCGGTATTCCATGTCCAACTATATGCTCGAGCATATAGTTGGACATGGAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201361.2-998s21c1
Sequence:CCGGTTGCCTGAAGAACCCTTATTACTCGAGTAATAAGGGTTCTTCAGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201361.2-1318s1c1
Sequence:CCGGCAGTTCTTTGAAGAGGTAAATCTCGAGATTTACCTCTTCAAAGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201361
VALIDATED
RMDN2 MISSION shRNA shRNA Plasmid DNA
regulator of microtubule dynamics 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201361.1-1636s1c1
Sequence:CCGGCCCTAGCAAATTGTTATTGTTCTCGAGAACAATAACAATTTGCTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201361.1-673s1c1
Sequence:CCGGCGGACAAATGAGTCTCACAAACTCGAGTTTGTGAGACTCATTTGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201361.2-813s21c1
Sequence:CCGGAGAAGCATTATGCTAATATTGCTCGAGCAATATTAGCATAATGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201361.2-1605s21c1
Sequence:CCGGGTAACCAATACGTAATCTAATCTCGAGATTAGATTACGTATTGGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201361.2-1093s21c1
Sequence:CCGGGTTCGGAGAAATACCATATTCCTCGAGGAATATGGTATTTCTCCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201361.2-1169s21c1
Sequence:CCGGTATTCCATGTCCAACTATATGCTCGAGCATATAGTTGGACATGGAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201361.2-998s21c1
Sequence:CCGGTTGCCTGAAGAACCCTTATTACTCGAGTAATAAGGGTTCTTCAGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201361.2-1318s1c1
Sequence:CCGGCAGTTCTTTGAAGAGGTAAATCTCGAGATTTACCTCTTCAAAGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201361
VALIDATED
RMDN2 MISSION shRNA Lentiviral Transduction Particles
regulator of microtubule dynamics 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201361.1-1636s1c1
Sequence:CCGGCCCTAGCAAATTGTTATTGTTCTCGAGAACAATAACAATTTGCTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201361.1-673s1c1
Sequence:CCGGCGGACAAATGAGTCTCACAAACTCGAGTTTGTGAGACTCATTTGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201361.2-813s21c1
Sequence:CCGGAGAAGCATTATGCTAATATTGCTCGAGCAATATTAGCATAATGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201361.2-1605s21c1
Sequence:CCGGGTAACCAATACGTAATCTAATCTCGAGATTAGATTACGTATTGGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201361.2-1093s21c1
Sequence:CCGGGTTCGGAGAAATACCATATTCCTCGAGGAATATGGTATTTCTCCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201361.2-1169s21c1
Sequence:CCGGTATTCCATGTCCAACTATATGCTCGAGCATATAGTTGGACATGGAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201361.2-998s21c1
Sequence:CCGGTTGCCTGAAGAACCCTTATTACTCGAGTAATAAGGGTTCTTCAGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201361.2-1318s1c1
Sequence:CCGGCAGTTCTTTGAAGAGGTAAATCTCGAGATTTACCTCTTCAAAGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)