EMAIL THIS PAGE TO A FRIEND

RMDN3

regulator of microtubule dynamics 3

46 Gene Product Result for
Synonyms: FAM82A2 FAM82C RMD-3 RMD3 ptpip51
Gene ID:
Mouse(67809) regulator of microtubule dynamics 3
Rat(311328) regulator of microtubule dynamics 3
Zebrafish(100034410) regulator of microtubule dynamics 3
cow(514748) family with sequence similarity 82, member A2
naked mole-rat(101715762) regulator of microtubule dynamics 3
domestic guinea pig(100716846) regulator of microtubule dynamics 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018145 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018145 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018145 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033136 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033136 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033136 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074461 MISSION® esiRNA esiRNA human FAM82A2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018145 Rosetta Predictions human pricing
NM_001014046 Rosetta Predictions rat pricing
NM_001033136 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018145 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212201 predicted 1778
2 SASI_Hs01_00212202 predicted 1911
3 SASI_Hs01_00212203 predicted 1069
4 SASI_Hs02_00351377 predicted 1593
5 SASI_Hs01_00212204 predicted 1983
6 SASI_Hs01_00212205 predicted 1937
7 SASI_Hs01_00212206 predicted 1609
8 SASI_Hs01_00212207 predicted 1994
9 SASI_Hs01_00212208 predicted 1756
10 SASI_Hs01_00212210 predicted 1618
11 SASI_Hs01_00212209 predicted 1675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014046 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033918 predicted 1147
2 SASI_Rn01_00033919 predicted 623
3 SASI_Rn02_00201437 predicted 1352
4 SASI_Rn02_00201438 predicted 976
5 SASI_Rn01_00033920 predicted 1362
6 SASI_Rn01_00033921 predicted 707
7 SASI_Rn01_00033922 predicted 239
8 SASI_Rn01_00033923 predicted 1392
9 SASI_Rn01_00033924 predicted 1445
10 SASI_Rn01_00033926 predicted 1472
11 SASI_Rn01_00033925 predicted 1547
12 SASI_Rn01_00033927 predicted 1403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033136 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027047 predicted 1712
2 SASI_Mm01_00027048 predicted 1852
3 SASI_Mm01_00027049 predicted 1644
4 SASI_Mm01_00027050 predicted 1687
5 SASI_Mm01_00027051 predicted 1785
6 SASI_Mm01_00027052 predicted 898
7 SASI_Mm01_00027053 predicted 1920
8 SASI_Mm01_00027054 predicted 1406
9 SASI_Mm01_00027055 predicted 1818
10 SASI_Mm01_00027056 predicted 1738
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018145
RMDN3 MISSION shRNA Bacterial Glycerol Stock
regulator of microtubule dynamics 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018145.1-1065s1c1
Sequence:CCGGGTGAGCGAGAAGAAGTCATATCTCGAGATATGACTTCTTCTCGCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018145.1-339s1c1
Sequence:CCGGGACTATACGCAGACTTCAGATCTCGAGATCTGAAGTCTGCGTATAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018145.1-809s1c1
Sequence:CCGGGAGAAAGGATTCTCTTGACTTCTCGAGAAGTCAAGAGAATCCTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135881    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018145.1-1679s1c1
Sequence:CCGGGAGATCAGGAAACCACACAAACTCGAGTTTGTGTGGTTTCCTGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018145.1-1413s1c1
Sequence:CCGGGAAGAACTACAGCCAGGATTTCTCGAGAAATCCTGGCTGTAGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018145.1-1618s21c1
Sequence:CCGGATGACTTGATGCCACTATTTACTCGAGTAAATAGTGGCATCAAGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018145.1-1436s21c1
Sequence:CCGGCAAAGCAGGAAGGGTATATATCTCGAGATATATACCCTTCCTGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018145
RMDN3 MISSION shRNA shRNA Plasmid DNA
regulator of microtubule dynamics 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018145.1-1065s1c1
Sequence:CCGGGTGAGCGAGAAGAAGTCATATCTCGAGATATGACTTCTTCTCGCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018145.1-339s1c1
Sequence:CCGGGACTATACGCAGACTTCAGATCTCGAGATCTGAAGTCTGCGTATAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018145.1-809s1c1
Sequence:CCGGGAGAAAGGATTCTCTTGACTTCTCGAGAAGTCAAGAGAATCCTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135881    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018145.1-1679s1c1
Sequence:CCGGGAGATCAGGAAACCACACAAACTCGAGTTTGTGTGGTTTCCTGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018145.1-1413s1c1
Sequence:CCGGGAAGAACTACAGCCAGGATTTCTCGAGAAATCCTGGCTGTAGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018145.1-1618s21c1
Sequence:CCGGATGACTTGATGCCACTATTTACTCGAGTAAATAGTGGCATCAAGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018145.1-1436s21c1
Sequence:CCGGCAAAGCAGGAAGGGTATATATCTCGAGATATATACCCTTCCTGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018145
RMDN3 MISSION shRNA Lentiviral Transduction Particles
regulator of microtubule dynamics 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018145.1-1065s1c1
Sequence:CCGGGTGAGCGAGAAGAAGTCATATCTCGAGATATGACTTCTTCTCGCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018145.1-339s1c1
Sequence:CCGGGACTATACGCAGACTTCAGATCTCGAGATCTGAAGTCTGCGTATAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018145.1-809s1c1
Sequence:CCGGGAGAAAGGATTCTCTTGACTTCTCGAGAAGTCAAGAGAATCCTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135881    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018145.1-1679s1c1
Sequence:CCGGGAGATCAGGAAACCACACAAACTCGAGTTTGTGTGGTTTCCTGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018145.1-1413s1c1
Sequence:CCGGGAAGAACTACAGCCAGGATTTCTCGAGAAATCCTGGCTGTAGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018145.1-1618s21c1
Sequence:CCGGATGACTTGATGCCACTATTTACTCGAGTAAATAGTGGCATCAAGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018145.1-1436s21c1
Sequence:CCGGCAAAGCAGGAAGGGTATATATCTCGAGATATATACCCTTCCTGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033136
VALIDATED
RMDN3 MISSION shRNA Bacterial Glycerol Stock
regulator of microtubule dynamics 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033136.2-1647s21c1
Sequence:CCGGTCTAATCTCCTACCTTAATTTCTCGAGAAATTAAGGTAGGAGATTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033136.2-1395s21c1
Sequence:CCGGGAACTGCCAGACGTCACTAATCTCGAGATTAGTGACGTCTGGCAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033136.2-1441s21c1
Sequence:CCGGTGGAAGAACTAGAAGTAATTTCTCGAGAAATTACTTCTAGTTCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033136.2-947s21c1
Sequence:CCGGGAAGAAGTCCTATGCCCTAAACTCGAGTTTAGGGCATAGGACTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033136.2-128s21c1
Sequence:CCGGTGGATTCCTGTGCGTCCTTTACTCGAGTAAAGGACGCACAGGAATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033136
VALIDATED
RMDN3 MISSION shRNA shRNA Plasmid DNA
regulator of microtubule dynamics 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033136.2-1647s21c1
Sequence:CCGGTCTAATCTCCTACCTTAATTTCTCGAGAAATTAAGGTAGGAGATTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033136.2-1395s21c1
Sequence:CCGGGAACTGCCAGACGTCACTAATCTCGAGATTAGTGACGTCTGGCAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033136.2-1441s21c1
Sequence:CCGGTGGAAGAACTAGAAGTAATTTCTCGAGAAATTACTTCTAGTTCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033136.2-947s21c1
Sequence:CCGGGAAGAAGTCCTATGCCCTAAACTCGAGTTTAGGGCATAGGACTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033136.2-128s21c1
Sequence:CCGGTGGATTCCTGTGCGTCCTTTACTCGAGTAAAGGACGCACAGGAATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033136
VALIDATED
RMDN3 MISSION shRNA Lentiviral Transduction Particles
regulator of microtubule dynamics 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033136.2-1647s21c1
Sequence:CCGGTCTAATCTCCTACCTTAATTTCTCGAGAAATTAAGGTAGGAGATTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033136.2-1395s21c1
Sequence:CCGGGAACTGCCAGACGTCACTAATCTCGAGATTAGTGACGTCTGGCAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033136.2-1441s21c1
Sequence:CCGGTGGAAGAACTAGAAGTAATTTCTCGAGAAATTACTTCTAGTTCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033136.2-947s21c1
Sequence:CCGGGAAGAAGTCCTATGCCCTAAACTCGAGTTTAGGGCATAGGACTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033136.2-128s21c1
Sequence:CCGGTGGATTCCTGTGCGTCCTTTACTCGAGTAAAGGACGCACAGGAATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)