EMAIL THIS PAGE TO A FRIEND

RMND5B

required for meiotic nuclear division 5 homolog B (S. cerevisiae)

49 Gene Product Result for
Synonyms: GID2 GID2B
UniProtKB ID: Q96G75, Q1HE27, Q6UVY7, Q9H6F6
Gene ID:
Mouse(66089) required for meiotic nuclear division 5 homolog B (S. cerevisiae)
Rat(497900) required for meiotic nuclear division 5 homolog B (S. cerevisiae)
Zebrafish(393747) required for meiotic nuclear division 5 homolog B (S. cerevisiae)
domestic cat(101088387) required for meiotic nuclear division 5 homolog B (S. cerevisiae)
dog(474643) required for meiotic nuclear division 5 homolog B (S. cerevisiae)
domestic guinea pig(100729497) required for meiotic nuclear division 5 homolog B (S. cerevisiae)
naked mole-rat(101710856) required for meiotic nuclear division 5 homolog B (S. cerevisiae)
Domestic Rabbit(100359203) required for meiotic nuclear division 5 homolog B (S. cerevisiae)
cow(515291) required for meiotic nuclear division 5 homolog B (S. cerevisiae)
sheep(101103063) required for meiotic nuclear division 5 homolog B (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022762 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022762 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022762 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025346 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025346 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025346 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022762 Rosetta Predictions human pricing
NM_001017473 Rosetta Predictions rat pricing
NM_025346 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165348 predicted 418
2 SASI_Hs02_00356031 predicted 1125
3 SASI_Hs01_00165350 predicted 1269
4 SASI_Hs01_00165351 predicted 477
5 SASI_Hs01_00165352 predicted 1233
6 SASI_Hs01_00165353 predicted 963
7 SASI_Hs01_00165354 predicted 453
8 SASI_Hs01_00165355 predicted 958
9 SASI_Hs01_00165356 predicted 1340
10 SASI_Hs01_00165357 predicted 1081
11 SASI_Hs01_00165349 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017473 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051717 predicted 232
2 SASI_Rn01_00051718 predicted 1080
3 SASI_Rn01_00051719 predicted 354
4 SASI_Rn01_00051720 predicted 1285
5 SASI_Rn01_00051721 predicted 1353
6 SASI_Rn01_00051723 predicted 962
7 SASI_Rn01_00051724 predicted 873
8 SASI_Rn01_00051725 predicted 422
9 SASI_Rn01_00051726 predicted 1297
10 SASI_Rn02_00202282 predicted 972
11 SASI_Rn01_00051722 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025346 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043350 predicted 1452
2 SASI_Mm01_00043351 predicted 588
3 SASI_Mm01_00043352 predicted 1250
4 SASI_Mm02_00328005 predicted 565
5 SASI_Mm01_00043354 predicted 1194
6 SASI_Mm01_00043355 predicted 1538
7 SASI_Mm01_00043357 predicted 624
8 SASI_Mm01_00043358 predicted 1332
9 SASI_Mm01_00043359 predicted 1149
10 SASI_Mm02_00328006 predicted 1304
11 SASI_Mm01_00043353 predicted 524
12 SASI_Mm01_00043356 predicted 1042
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022762
RMND5B MISSION shRNA Bacterial Glycerol Stock
required for meiotic nuclear division 5 homolog B (S. cerevisiae)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022762.3-1617s21c1
Sequence:CCGGTTCTGTTTGCGTTTGACTTAGCTCGAGCTAAGTCAAACGCAAACAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022762.3-1270s21c1
Sequence:CCGGGCACTCAATAAGCTCATTAATCTCGAGATTAATGAGCTTATTGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022762.3-627s21c1
Sequence:CCGGCTTGGATTTCAAGCAGCCTTTCTCGAGAAAGGCTGCTTGAAATCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022762.3-1062s21c1
Sequence:CCGGGCTGCCTGTGTTGATGAACATCTCGAGATGTTCATCAACACAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022762.3-406s1c1
Sequence:CCGGGCTTCGGACCATAAGGACATTCTCGAGAATGTCCTTATGGTCCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022762.3-1270s1c1
Sequence:CCGGGCACTCAATAAGCTCATTAATCTCGAGATTAATGAGCTTATTGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022762.3-1336s1c1
Sequence:CCGGGCAGATGGGAAACGCATCATACTCGAGTATGATGCGTTTCCCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022762.3-627s1c1
Sequence:CCGGCTTGGATTTCAAGCAGCCTTTCTCGAGAAAGGCTGCTTGAAATCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022762.3-1336s21c1
Sequence:CCGGGCAGATGGGAAACGCATCATACTCGAGTATGATGCGTTTCCCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022762.3-1062s1c1
Sequence:CCGGGCTGCCTGTGTTGATGAACATCTCGAGATGTTCATCAACACAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022762.3-1421s21c1
Sequence:CCGGTCGGTAGGGTGGTCAACTTCACTCGAGTGAAGTTGACCACCCTACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022762
RMND5B MISSION shRNA shRNA Plasmid DNA
required for meiotic nuclear division 5 homolog B (S. cerevisiae)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022762.3-1617s21c1
Sequence:CCGGTTCTGTTTGCGTTTGACTTAGCTCGAGCTAAGTCAAACGCAAACAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022762.3-1270s21c1
Sequence:CCGGGCACTCAATAAGCTCATTAATCTCGAGATTAATGAGCTTATTGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022762.3-627s21c1
Sequence:CCGGCTTGGATTTCAAGCAGCCTTTCTCGAGAAAGGCTGCTTGAAATCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022762.3-1062s21c1
Sequence:CCGGGCTGCCTGTGTTGATGAACATCTCGAGATGTTCATCAACACAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022762.3-406s1c1
Sequence:CCGGGCTTCGGACCATAAGGACATTCTCGAGAATGTCCTTATGGTCCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022762.3-1270s1c1
Sequence:CCGGGCACTCAATAAGCTCATTAATCTCGAGATTAATGAGCTTATTGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022762.3-1336s1c1
Sequence:CCGGGCAGATGGGAAACGCATCATACTCGAGTATGATGCGTTTCCCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022762.3-627s1c1
Sequence:CCGGCTTGGATTTCAAGCAGCCTTTCTCGAGAAAGGCTGCTTGAAATCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022762.3-1336s21c1
Sequence:CCGGGCAGATGGGAAACGCATCATACTCGAGTATGATGCGTTTCCCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022762.3-1062s1c1
Sequence:CCGGGCTGCCTGTGTTGATGAACATCTCGAGATGTTCATCAACACAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022762.3-1421s21c1
Sequence:CCGGTCGGTAGGGTGGTCAACTTCACTCGAGTGAAGTTGACCACCCTACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022762
RMND5B MISSION shRNA Lentiviral Transduction Particles
required for meiotic nuclear division 5 homolog B (S. cerevisiae)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022762.3-1617s21c1
Sequence:CCGGTTCTGTTTGCGTTTGACTTAGCTCGAGCTAAGTCAAACGCAAACAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022762.3-1270s21c1
Sequence:CCGGGCACTCAATAAGCTCATTAATCTCGAGATTAATGAGCTTATTGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022762.3-627s21c1
Sequence:CCGGCTTGGATTTCAAGCAGCCTTTCTCGAGAAAGGCTGCTTGAAATCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022762.3-1062s21c1
Sequence:CCGGGCTGCCTGTGTTGATGAACATCTCGAGATGTTCATCAACACAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022762.3-406s1c1
Sequence:CCGGGCTTCGGACCATAAGGACATTCTCGAGAATGTCCTTATGGTCCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022762.3-1270s1c1
Sequence:CCGGGCACTCAATAAGCTCATTAATCTCGAGATTAATGAGCTTATTGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022762.3-1336s1c1
Sequence:CCGGGCAGATGGGAAACGCATCATACTCGAGTATGATGCGTTTCCCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022762.3-627s1c1
Sequence:CCGGCTTGGATTTCAAGCAGCCTTTCTCGAGAAAGGCTGCTTGAAATCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022762.3-1336s21c1
Sequence:CCGGGCAGATGGGAAACGCATCATACTCGAGTATGATGCGTTTCCCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022762.3-1062s1c1
Sequence:CCGGGCTGCCTGTGTTGATGAACATCTCGAGATGTTCATCAACACAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022762.3-1421s21c1
Sequence:CCGGTCGGTAGGGTGGTCAACTTCACTCGAGTGAAGTTGACCACCCTACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025346
VALIDATED
RMND5B MISSION shRNA Bacterial Glycerol Stock
required for meiotic nuclear division 5 homolog B (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025346.1-1300s21c1
Sequence:CCGGCACAAGGATGAGTTGCCGATTCTCGAGAATCGGCAACTCATCCTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025346.1-1240s21c1
Sequence:CCGGCCCGTGCTGATGAACATTAAACTCGAGTTTAATGTTCATCAGCACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025346.1-1760s21c1
Sequence:CCGGCAAAGGTCTTGGTCATCAAATCTCGAGATTTGATGACCAAGACCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025346.1-396s1c1
Sequence:CCGGCCTGCACAAGTTCCTAACCTACTCGAGTAGGTTAGGAACTTGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025346.1-580s1c1
Sequence:CCGGGCTTCCGACCATAAGGACATTCTCGAGAATGTCCTTATGGTCGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025346.1-822s1c1
Sequence:CCGGCTTGGAGTTGAATCGGATCTTCTCGAGAAGATCCGATTCAACTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025346.1-1300s1c1
Sequence:CCGGCACAAGGATGAGTTGCCGATTCTCGAGAATCGGCAACTCATCCTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025346.1-1457s1c1
Sequence:CCGGTCATCAATGGAGGAAAGCTAACTCGAGTTAGCTTTCCTCCATTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025346.1-1511s21c1
Sequence:CCGGCAGATGGGAAACGCATCATATCTCGAGATATGATGCGTTTCCCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025346.1-822s21c1
Sequence:CCGGCTTGGAGTTGAATCGGATCTTCTCGAGAAGATCCGATTCAACTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025346
VALIDATED
RMND5B MISSION shRNA shRNA Plasmid DNA
required for meiotic nuclear division 5 homolog B (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025346.1-1300s21c1
Sequence:CCGGCACAAGGATGAGTTGCCGATTCTCGAGAATCGGCAACTCATCCTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025346.1-1240s21c1
Sequence:CCGGCCCGTGCTGATGAACATTAAACTCGAGTTTAATGTTCATCAGCACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025346.1-1760s21c1
Sequence:CCGGCAAAGGTCTTGGTCATCAAATCTCGAGATTTGATGACCAAGACCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025346.1-396s1c1
Sequence:CCGGCCTGCACAAGTTCCTAACCTACTCGAGTAGGTTAGGAACTTGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025346.1-580s1c1
Sequence:CCGGGCTTCCGACCATAAGGACATTCTCGAGAATGTCCTTATGGTCGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025346.1-822s1c1
Sequence:CCGGCTTGGAGTTGAATCGGATCTTCTCGAGAAGATCCGATTCAACTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025346.1-1300s1c1
Sequence:CCGGCACAAGGATGAGTTGCCGATTCTCGAGAATCGGCAACTCATCCTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025346.1-1457s1c1
Sequence:CCGGTCATCAATGGAGGAAAGCTAACTCGAGTTAGCTTTCCTCCATTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025346.1-1511s21c1
Sequence:CCGGCAGATGGGAAACGCATCATATCTCGAGATATGATGCGTTTCCCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025346.1-822s21c1
Sequence:CCGGCTTGGAGTTGAATCGGATCTTCTCGAGAAGATCCGATTCAACTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025346
VALIDATED
RMND5B MISSION shRNA Lentiviral Transduction Particles
required for meiotic nuclear division 5 homolog B (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025346.1-1300s21c1
Sequence:CCGGCACAAGGATGAGTTGCCGATTCTCGAGAATCGGCAACTCATCCTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025346.1-1240s21c1
Sequence:CCGGCCCGTGCTGATGAACATTAAACTCGAGTTTAATGTTCATCAGCACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025346.1-1760s21c1
Sequence:CCGGCAAAGGTCTTGGTCATCAAATCTCGAGATTTGATGACCAAGACCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025346.1-396s1c1
Sequence:CCGGCCTGCACAAGTTCCTAACCTACTCGAGTAGGTTAGGAACTTGTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025346.1-580s1c1
Sequence:CCGGGCTTCCGACCATAAGGACATTCTCGAGAATGTCCTTATGGTCGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025346.1-822s1c1
Sequence:CCGGCTTGGAGTTGAATCGGATCTTCTCGAGAAGATCCGATTCAACTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025346.1-1300s1c1
Sequence:CCGGCACAAGGATGAGTTGCCGATTCTCGAGAATCGGCAACTCATCCTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025346.1-1457s1c1
Sequence:CCGGTCATCAATGGAGGAAAGCTAACTCGAGTTAGCTTTCCTCCATTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025346.1-1511s21c1
Sequence:CCGGCAGATGGGAAACGCATCATATCTCGAGATATGATGCGTTTCCCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025346.1-822s21c1
Sequence:CCGGCTTGGAGTTGAATCGGATCTTCTCGAGAAGATCCGATTCAACTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)